| Product name: | Colletotrichum acutatum |
| Testo id: | TS996204 |
| Species Name: | Colletotrichum acutatum |
| Type: | |
| Synonyms: | Glomerella acutata |
| Taxonomy: | FUNGI Ascomycota, Sordariomycetes, Glomerellales, Glomerellaceae |
| Strain History: | Maloy, O.T. -> UAMH |
| Substrate: | sprouts and seed of mung bean Paseolus aureus, causing rapid decay of sprouts in sprouting chambers |
| Isolator: | O. Maloy |
| Isolation Date: | |
| Date Received: | 1982-10-18 |
| Characters: | MOLECULAR SYSTEMATICS Blast match 100% ITS similarity with Colletotrichum acutatum species complex // MOLECULAR SYSTEMATICS sequencing from other gene regions needed to confirm species identification // PLANT PATHOGEN caused rapid decay of mung bean (Paseolus aureus) sprouts in sprouting chambers - fide O.T. Maloy 1982 |
| Compounds: | |
| Cross Reference: | |
| Pathogenic Potential: | Human: no | Animal: no | Plant: yes |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic Peoples Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 440865 |
| Sequences: | >UAMH04661_ITS CATTACTGAGTTACCGCTCTATAACCCTTTGTGAACATACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGCGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGCCGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCCCACGGCACACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCACTGGGATTCGGAGGGACTCTTGCCGTAAAACCCCCAAATTTTTTACAGGTTGACCTCGGATCAGGTA |
| Product name: | Colletotrichum acutatum |
| Testo id: | TS996204 |
| Species Name: | Colletotrichum acutatum |
| Type: | |
| Synonyms: | Glomerella acutata |
| Taxonomy: | FUNGI Ascomycota, Sordariomycetes, Glomerellales, Glomerellaceae |
| Strain History: | Maloy, O.T. -> UAMH |
| Substrate: | sprouts and seed of mung bean Paseolus aureus, causing rapid decay of sprouts in sprouting chambers |
| Isolator: | O. Maloy |
| Isolation Date: | |
| Date Received: | 1982-10-18 |
| Characters: | MOLECULAR SYSTEMATICS Blast match 100% ITS similarity with Colletotrichum acutatum species complex // MOLECULAR SYSTEMATICS sequencing from other gene regions needed to confirm species identification // PLANT PATHOGEN caused rapid decay of mung bean (Paseolus aureus) sprouts in sprouting chambers - fide O.T. Maloy 1982 |
| Compounds: | |
| Cross Reference: | |
| Pathogenic Potential: | Human: no | Animal: no | Plant: yes |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic Peoples Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 440865 |
| Sequences: | >UAMH04661_ITS CATTACTGAGTTACCGCTCTATAACCCTTTGTGAACATACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGCGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGCCGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCCCACGGCACACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCACTGGGATTCGGAGGGACTCTTGCCGTAAAACCCCCAAATTTTTTACAGGTTGACCTCGGATCAGGTA |