| Product name: | Arachnomyces kanei |
| Testo id: | TS1000238 |
| Species Name: | Arachnomyces kanei |
| Type: | |
| Synonyms: | |
| Taxonomy: | FUNGI Ascomycota, Eurotiomycetes, Arachnomycetales, Arachnomycetaceae |
| Strain History: | Summerbell, R.C. (F 10296) -> UAMH |
| Substrate: | swab of left great toenail, male 78 yr, DE+ for irregular filaments, same patient as UAMH 9022 |
| Isolator: | |
| Isolation Date: | 1996-09-23 |
| Date Received: | 1997-08-19 |
| Characters: | HUMAN/ ANIMAL PATHOGEN onychomycosis - Gibas, Sigler, Summerbell et al., Med. Mycol. 40:573-580, 2002 // MOLECULAR SYSTEMATICS ITS1 sequence analysis - Gibas, Sigler, Summerbell et al., Med. Mycol. 40:573-580, 2002 // PIGMENT brown/yellow |
| Compounds: | |
| Cross Reference: | |
| Pathogenic Potential: | Human: yes | Animal: no | Plant: no |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 483954 |
| Sequences: | >UAMH09024_AY123782_LSU GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCTCAAGCGCGGCTTGTGTGTTGGGCTCCGCCCCCCGTACTTGGGGGGGCGCGCCCGAAAGGCAGTGGCGGCGCCGTGCCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGGAGGCCCGGCCGGTCGCCGCCGACCCAACCTTCCAACCTATCTTTACCGGTTGACCTCGGATCAGG |
| Product name: | Arachnomyces kanei |
| Testo id: | TS1000238 |
| Species Name: | Arachnomyces kanei |
| Type: | |
| Synonyms: | |
| Taxonomy: | FUNGI Ascomycota, Eurotiomycetes, Arachnomycetales, Arachnomycetaceae |
| Strain History: | Summerbell, R.C. (F 10296) -> UAMH |
| Substrate: | swab of left great toenail, male 78 yr, DE+ for irregular filaments, same patient as UAMH 9022 |
| Isolator: | |
| Isolation Date: | 1996-09-23 |
| Date Received: | 1997-08-19 |
| Characters: | HUMAN/ ANIMAL PATHOGEN onychomycosis - Gibas, Sigler, Summerbell et al., Med. Mycol. 40:573-580, 2002 // MOLECULAR SYSTEMATICS ITS1 sequence analysis - Gibas, Sigler, Summerbell et al., Med. Mycol. 40:573-580, 2002 // PIGMENT brown/yellow |
| Compounds: | |
| Cross Reference: | |
| Pathogenic Potential: | Human: yes | Animal: no | Plant: no |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 483954 |
| Sequences: | >UAMH09024_AY123782_LSU GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCTCAAGCGCGGCTTGTGTGTTGGGCTCCGCCCCCCGTACTTGGGGGGGCGCGCCCGAAAGGCAGTGGCGGCGCCGTGCCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGGAGGCCCGGCCGGTCGCCGCCGACCCAACCTTCCAACCTATCTTTACCGGTTGACCTCGGATCAGG |