| Product name: | Mucor circinelloides |
| Testo id: | TS1001477 |
| Species Name: | Mucor circinelloides |
| Type: | |
| Synonyms: | Calyptromyces circinelloides / Circinomucor circinelloides / Mucor alternans / Mucor ambiguus / Mucor circinelloides var. circinelloides / Mucor circinelloides var. mandshuricus / Mucor dubius / Mucor griseoroseus / Mucor javanicus / Mucor mandshuricus / Mucor prainii / Mucor ramificus / Rhizomucor regularior / Rhizomucor variabilis var. regularior |
| Taxonomy: | FUNGI Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae |
| Strain History: | Iwen, P. (UNMC 090803) -> UAMH |
| Substrate: | ulcer on left calf, male 90 yr; biopsy + for hyphae with few septa and thick-walled yeast forms |
| Isolator: | P. Iwen |
| Isolation Date: | 2016-03-10 |
| Date Received: | 2003-12-22 |
| Characters: | CULTURE CONDITIONS no zygospores in matings with UAMH 8306 or 8307 // HUMAN/ ANIMAL PATHOGEN primary cutaneous infection - Iwen PC, Sigler L, Freifeld AG, J Clin Microbiol 45:636-640, 2007 // MOLECULAR SYSTEMATICS ITS sequence comparison showed 99% similarity with GenBank sequence for Mucor circinelloides |
| Compounds: | |
| Cross Reference: | UNMC 090803 |
| Pathogenic Potential: | Human: yes | Animal: yes | Plant: no |
| Biosafety Risk Group: | RG2 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) and a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic Peoples Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 198947 |
| Sequences: | >UAMH10385_DQ787159_SSU-LSU AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAATAATCAATAATTTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAGGGATGCTCCACTGCTATAAGGATAGGCGATGGAGATGCTAACCGAGTCATAATCAAGCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAGACATTTTGTTGAATAGGAATACTGAGAGTCTCTTGATCTATTCTGATCTCGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTTTGAATGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGGTAAACTGTGCTGGGGCCTCCCAAATAATACTTTTTTTAAATTTGATCTAAATCAGGCGGGA |
| Product name: | Mucor circinelloides |
| Testo id: | TS1001477 |
| Species Name: | Mucor circinelloides |
| Type: | |
| Synonyms: | Calyptromyces circinelloides / Circinomucor circinelloides / Mucor alternans / Mucor ambiguus / Mucor circinelloides var. circinelloides / Mucor circinelloides var. mandshuricus / Mucor dubius / Mucor griseoroseus / Mucor javanicus / Mucor mandshuricus / Mucor prainii / Mucor ramificus / Rhizomucor regularior / Rhizomucor variabilis var. regularior |
| Taxonomy: | FUNGI Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae |
| Strain History: | Iwen, P. (UNMC 090803) -> UAMH |
| Substrate: | ulcer on left calf, male 90 yr; biopsy + for hyphae with few septa and thick-walled yeast forms |
| Isolator: | P. Iwen |
| Isolation Date: | 2016-03-10 |
| Date Received: | 2003-12-22 |
| Characters: | CULTURE CONDITIONS no zygospores in matings with UAMH 8306 or 8307 // HUMAN/ ANIMAL PATHOGEN primary cutaneous infection - Iwen PC, Sigler L, Freifeld AG, J Clin Microbiol 45:636-640, 2007 // MOLECULAR SYSTEMATICS ITS sequence comparison showed 99% similarity with GenBank sequence for Mucor circinelloides |
| Compounds: | |
| Cross Reference: | UNMC 090803 |
| Pathogenic Potential: | Human: yes | Animal: yes | Plant: no |
| Biosafety Risk Group: | RG2 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) and a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic Peoples Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 198947 |
| Sequences: | >UAMH10385_DQ787159_SSU-LSU AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAATAATCAATAATTTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAGGGATGCTCCACTGCTATAAGGATAGGCGATGGAGATGCTAACCGAGTCATAATCAAGCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAGACATTTTGTTGAATAGGAATACTGAGAGTCTCTTGATCTATTCTGATCTCGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTTTGAATGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGGTAAACTGTGCTGGGGCCTCCCAAATAATACTTTTTTTAAATTTGATCTAAATCAGGCGGGA |