| 产品名称: | pRSVhPit-1v |
|---|---|
| 商品货号: | TS131991 |
| Designations: | pRSVhPit-1v |
| GenBank Number: | X72215 |
| Species: | Homo sapiens, human |
| Applications: | in another host, produces protein pituitary-specific transcription factor (growth hormone factor 1) |
| Vector: | Construct size (kb): 5.599999904632568 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pRSVcat Intact vector size: 5.100 Type of vector: plasmid Vector end: XmaI Vector end: XbaI Cloning sites: BamHI HindIII Polylinker sites: Construction: pSV2-betaG, Tn9, RSV Host range: vertebrate cells; Escherichia coli Features (with orientation and position when available): enhancer: RSV marker(s): ampR, cmLR promoter: RSV LTR replicon: pMB1 Cross references: |
| Insert: | DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: PIT1 Genomic copy number: unique Gene name: pituitary-specific transcription factor (growth hormone factor 1) Contains complete coding sequence?: Y Chromosome: 3; Localization: 3 p11 Tissue: pituitary Type of DNA: cDNA Insert 5 end: XmaI Insert 3 end: XbaI Insert size (kb): 1.0 Cross references: DNA Seq. Acc.: X72215 Insert lengths(kb): 1.0 Tissue: pituitary Gene product: pituitary-specific transcription factor (growth hormone factor 1) PIT1 Target Gene: pituitary-specific transcription factor (growth hormone factor 1) |
| Insert Size (kb): | 1.0 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments: | Restriction digests of the clone give the following sizes (kb): EcoRI--2.7, 2.1, 0.4, 0.24; PstI--2.5, 1.8, 1.0; PvuII--5.4; SphI--4.6, 0.9; SmaI/XbaI--4.4, 1.1. Insert contains the following restriction sites (approximate kb from the 5 end): EcoRI--0.11, 0.56; PstI--0.6; PvuII--0.38, 0.54; SphI--0.62. Contains the complete coding sequence plus portions of the 5 and 3 untranslated regions. This clone varies from other published sequence(s): GenBank records X62429, D01114. The aa sequence differences determined by GenBank X72215 are: Q4R, D227Y. The ends of the PIT1-specific portions of the primers used to amplify this sequence correspond to nt 56-1046 of GenBank record D01114. In this record, the coding region extends from nt 126-1001. Insert was amplified using the following primers: 5CCCCCCGGGAGACAGTAATATAATAA 3(5 untranslated region) and 5CCCTCTAGAGAAGGAATGAAACGGG 3 (3 untranslated region). |
| References: | Pernasetti F, et al. Cloning of a human GHF-1/Pit-1 cDNA variant. Nucleic Acids Res. 21: 3584, 1993. PubMed: 8346040 |
| 产品名称: | pRSVhPit-1v |
|---|---|
| 商品货号: | TS131991 |
| Designations: | pRSVhPit-1v |
| GenBank Number: | X72215 |
| Species: | Homo sapiens, human |
| Applications: | in another host, produces protein pituitary-specific transcription factor (growth hormone factor 1) |
| Vector: | Construct size (kb): 5.599999904632568 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pRSVcat Intact vector size: 5.100 Type of vector: plasmid Vector end: XmaI Vector end: XbaI Cloning sites: BamHI HindIII Polylinker sites: Construction: pSV2-betaG, Tn9, RSV Host range: vertebrate cells; Escherichia coli Features (with orientation and position when available): enhancer: RSV marker(s): ampR, cmLR promoter: RSV LTR replicon: pMB1 Cross references: |
| Insert: | DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: PIT1 Genomic copy number: unique Gene name: pituitary-specific transcription factor (growth hormone factor 1) Contains complete coding sequence?: Y Chromosome: 3; Localization: 3 p11 Tissue: pituitary Type of DNA: cDNA Insert 5 end: XmaI Insert 3 end: XbaI Insert size (kb): 1.0 Cross references: DNA Seq. Acc.: X72215 Insert lengths(kb): 1.0 Tissue: pituitary Gene product: pituitary-specific transcription factor (growth hormone factor 1) PIT1 Target Gene: pituitary-specific transcription factor (growth hormone factor 1) |
| Insert Size (kb): | 1.0 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments: | Restriction digests of the clone give the following sizes (kb): EcoRI--2.7, 2.1, 0.4, 0.24; PstI--2.5, 1.8, 1.0; PvuII--5.4; SphI--4.6, 0.9; SmaI/XbaI--4.4, 1.1. Insert contains the following restriction sites (approximate kb from the 5 end): EcoRI--0.11, 0.56; PstI--0.6; PvuII--0.38, 0.54; SphI--0.62. Contains the complete coding sequence plus portions of the 5 and 3 untranslated regions. This clone varies from other published sequence(s): GenBank records X62429, D01114. The aa sequence differences determined by GenBank X72215 are: Q4R, D227Y. The ends of the PIT1-specific portions of the primers used to amplify this sequence correspond to nt 56-1046 of GenBank record D01114. In this record, the coding region extends from nt 126-1001. Insert was amplified using the following primers: 5CCCCCCGGGAGACAGTAATATAATAA 3(5 untranslated region) and 5CCCTCTAGAGAAGGAATGAAACGGG 3 (3 untranslated region). |
| References: | Pernasetti F, et al. Cloning of a human GHF-1/Pit-1 cDNA variant. Nucleic Acids Res. 21: 3584, 1993. PubMed: 8346040 |