| 产品名称: | Colletotrichum acutatum Simmonds |
|---|---|
| 商品货号: | TS133147 |
| Strain Designations: | 02-163 |
| Alternate State: | Glomerella acutata Guerber et Correll, teleomorph |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Plant pathogen; responsible for anthracnose of of strawberry. Reference isolate of C. acutatum strain on strawberry in Florida. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 20.0-25.0°C |
| Sequenced Data: | >ITS DNA sequence for MYA-4519
CCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGCGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGCCGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCCCACGGCACACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCACTGGGATTCGGAGGGACTCTTGCCGTAAAACCCCCAAATTTTTTACAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT |
| Name of Depositor: | SJ MacKenzie |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | strawberry, Florida, USA. |
| Cross References: | Nucleotide (GenBank) : FJ810514 ITS including 5.8S rRNA gene |
| References: | Freeman S, Katan T. Identification of Colletotrichum species responsible for anthracnose and root necrosis of strawberry in Israel. Phytopathology 87: 516-521, 1997. MacKenzie SJ, et al. Host Range and Genetic Relatedness of Colletotrichum acutatum Isolates from Fruit Crops and Leatherleaf Fern in Florida. Phytopathology 99: 620-631, 2009. |
| 产品名称: | Colletotrichum acutatum Simmonds |
|---|---|
| 商品货号: | TS133147 |
| Strain Designations: | 02-163 |
| Alternate State: | Glomerella acutata Guerber et Correll, teleomorph |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Plant pathogen; responsible for anthracnose of of strawberry. Reference isolate of C. acutatum strain on strawberry in Florida. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 20.0-25.0°C |
| Sequenced Data: | >ITS DNA sequence for MYA-4519
CCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGCGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGCCGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCCCACGGCACACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCACTGGGATTCGGAGGGACTCTTGCCGTAAAACCCCCAAATTTTTTACAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT |
| Name of Depositor: | SJ MacKenzie |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | strawberry, Florida, USA. |
| Cross References: | Nucleotide (GenBank) : FJ810514 ITS including 5.8S rRNA gene |
| References: | Freeman S, Katan T. Identification of Colletotrichum species responsible for anthracnose and root necrosis of strawberry in Israel. Phytopathology 87: 516-521, 1997. MacKenzie SJ, et al. Host Range and Genetic Relatedness of Colletotrichum acutatum Isolates from Fruit Crops and Leatherleaf Fern in Florida. Phytopathology 99: 620-631, 2009. |