| 产品名称: | Neurospora sitophila Shear et Dodge, teleomorph |
|---|---|
| 商品货号: | TS135454 |
| Strain Designations: | NRRL 2884 |
| Application: | degrades cellulose produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase produces protease nonstructural protein 3 produces single-cell protein SCP produces single-cell protein from cellulose reduces chemical oxygen demand (COD) of potato effluent |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Mating Type: | mating type minus |
| Comments: | Impeller-associated shear effects during fermentation
The DNA sequences indicate that this strain is phylogenetically closer to Neurospora intermedia than Neurospora sitophila. |
| Morphology: | After 5 days on Neurospora medium at 25°C, colony is low, velutinous, buff-colored. Hyphae hyaline, geniculate. After 2 months, arthroconidia abundant, ellipsoidal or irregularly shaped. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 331: Neurospora culture agar |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGCCTCGGCGCTGGCGGTCCGGAAAGGCCCTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGAGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGATGCCGATCCAATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCGCCGTTCCGATCATCCGGTGTTCTCACCGGTGCACTCGGGACGGCTCAGGCCAGCATCGGTTTTGGCGGGGGGATAAAGGTTCGGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCCGGGCGTAATGCCCTCGCCGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC |
| Name of Depositor: | NRRL |
| References: | . . Prog. Biotechnol. 9: 961-964, 1994. . . Biotechnol. Lett. 14: 863-868, 1992. . . Resour. Conserv. Recycl. 13: 139-146, 1995. Beuchat LR, Basha SM. Protease production by the ontjom fungus, Neurospora sitophila. Eur. J. Appl. Microbiol. 2: 195-203, 1976. Karim MI, Sistrunk WA. Efficiency of selected strains of fungi in reducing chemical oxygen demand in wastewater from steam-peeled potatoes. J. Food Process Preserv. 8: 211-218, 1984. Oguntimein GB, Moo-Young M. Production and properties of beta-glucosidase by Neurospora sitophila. World J. Microbiol. Biotechnol. 7: 4-11, 1991. |
| 产品名称: | Neurospora sitophila Shear et Dodge, teleomorph |
|---|---|
| 商品货号: | TS135454 |
| Strain Designations: | NRRL 2884 |
| Application: | degrades cellulose produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase produces protease nonstructural protein 3 produces single-cell protein SCP produces single-cell protein from cellulose reduces chemical oxygen demand (COD) of potato effluent |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Mating Type: | mating type minus |
| Comments: | Impeller-associated shear effects during fermentation
The DNA sequences indicate that this strain is phylogenetically closer to Neurospora intermedia than Neurospora sitophila. |
| Morphology: | After 5 days on Neurospora medium at 25°C, colony is low, velutinous, buff-colored. Hyphae hyaline, geniculate. After 2 months, arthroconidia abundant, ellipsoidal or irregularly shaped. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 331: Neurospora culture agar |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGCCTCGGCGCTGGCGGTCCGGAAAGGCCCTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGAGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGATGCCGATCCAATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCGCCGTTCCGATCATCCGGTGTTCTCACCGGTGCACTCGGGACGGCTCAGGCCAGCATCGGTTTTGGCGGGGGGATAAAGGTTCGGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCCGGGCGTAATGCCCTCGCCGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC |
| Name of Depositor: | NRRL |
| References: | . . Prog. Biotechnol. 9: 961-964, 1994. . . Biotechnol. Lett. 14: 863-868, 1992. . . Resour. Conserv. Recycl. 13: 139-146, 1995. Beuchat LR, Basha SM. Protease production by the ontjom fungus, Neurospora sitophila. Eur. J. Appl. Microbiol. 2: 195-203, 1976. Karim MI, Sistrunk WA. Efficiency of selected strains of fungi in reducing chemical oxygen demand in wastewater from steam-peeled potatoes. J. Food Process Preserv. 8: 211-218, 1984. Oguntimein GB, Moo-Young M. Production and properties of beta-glucosidase by Neurospora sitophila. World J. Microbiol. Biotechnol. 7: 4-11, 1991. |