| 产品名称: | Quantitative Synthetic Human papillomavirus 16 DNA |
|---|---|
| 商品货号: | TS136190 |
| Agent: | Quantitative Synthetic Human papillomavirus 16 DNA |
| Common Name: | HPV-16 |
| Applications: | ATCC®xa0Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial with Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification,
or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes full length genome of human papillomavirus type 16 (HPV-16) xa0derived from a plasmid clone (ATCC® 45113D™). The following primers and probe can be used with this nucleic acid preparation Ref ![]() Seaman WT, et al. Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR. Virol. J. 7: 194, 2010. PubMed: 20723234:Forward primer: TTGTTGGGGTAACCAACTATTTGTTACTGTT Reverse primer: CCTCCCCATGTCTGAGGTACTCCTTAAAG Probe: FAM-GTCATTATGTGCTGCCATATCTACTTC-BHQ |
| Special Collection: | DNA |
| References: | Seaman WT, et al. Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR. Virol. J. 7: 194, 2010. PubMed: 20723234 |
| Cross References: | Nucleotide (GenBank) : HPU89348 Human papillomavirus type 16 variant, complete sequence |
| 产品名称: | Quantitative Synthetic Human papillomavirus 16 DNA |
|---|---|
| 商品货号: | TS136190 |
| Agent: | Quantitative Synthetic Human papillomavirus 16 DNA |
| Common Name: | HPV-16 |
| Applications: | ATCC®xa0Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial with Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification,
or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes full length genome of human papillomavirus type 16 (HPV-16) xa0derived from a plasmid clone (ATCC® 45113D™). The following primers and probe can be used with this nucleic acid preparation Ref ![]() Seaman WT, et al. Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR. Virol. J. 7: 194, 2010. PubMed: 20723234:Forward primer: TTGTTGGGGTAACCAACTATTTGTTACTGTT Reverse primer: CCTCCCCATGTCTGAGGTACTCCTTAAAG Probe: FAM-GTCATTATGTGCTGCCATATCTACTTC-BHQ |
| Special Collection: | DNA |
| References: | Seaman WT, et al. Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR. Virol. J. 7: 194, 2010. PubMed: 20723234 |
| Cross References: | Nucleotide (GenBank) : HPU89348 Human papillomavirus type 16 variant, complete sequence |