| 产品名称: | Suhomyces kunorum (Suh et Blackwell) Blackwell et Kurtzman |
|---|---|
| 商品货号: | TS138472 |
| Deposited As: | Candida kunorum Suh et Blackwell |
| Strain Designations: | BG 02-7-18-017A-1-1 CBS 9825, NRRL Y-27580 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TCGTAACAAGGTTTCTGTAGGTGAACCTGCGGAAGGATCATTAAAACAAACATCGTCACACTTTGGATTCCAGATTTGGCGGCTTGCCGCCAAAGACCACACGCGAATAATGTGTCTACAACCAACTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATACGAATTGCAGCCTTTGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTCAGACTCCCTCTAACCGCCGGTTAGGCTGTGAGTGCACACGCGTCTGCTCGAAAAACATCTGAACGTGTCTAGGATCACCCCCCATGTTCAATTTTTCTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA |
| Name of Depositor: | SO Suh |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Teichostethus testaceous (Nitidulidae) ex Nodulisporium sp., Barro Colorado Island, Panama |
| Cross References: | Nucleotide (GenBank) : FJ172246 ITS including 5.8S rRNA gene |
| References: | Suh SO, et al. Expansion of the Candida tanzawaensis yeast clade: 16 novel Candida species from basidiocarp-feeding beetles. Int J Syst Evol Microbiol 54: 2409-2429, 2004. PubMed: 15545491 Kurtzman CP, Robnett CJ, Blackwell M. Description of Teunomyces gen. nov. for the Candida kruisii clade, Suhomyces gen. nov. for the Candida tanzawaensis clade and Suhomyces kilbournensis sp. nov. FEMS Yeast Res 16(5). pii: fow041, 2016. PubMed: 27188882 |
| 产品名称: | Suhomyces kunorum (Suh et Blackwell) Blackwell et Kurtzman |
|---|---|
| 商品货号: | TS138472 |
| Deposited As: | Candida kunorum Suh et Blackwell |
| Strain Designations: | BG 02-7-18-017A-1-1 CBS 9825, NRRL Y-27580 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TCGTAACAAGGTTTCTGTAGGTGAACCTGCGGAAGGATCATTAAAACAAACATCGTCACACTTTGGATTCCAGATTTGGCGGCTTGCCGCCAAAGACCACACGCGAATAATGTGTCTACAACCAACTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATACGAATTGCAGCCTTTGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTCAGACTCCCTCTAACCGCCGGTTAGGCTGTGAGTGCACACGCGTCTGCTCGAAAAACATCTGAACGTGTCTAGGATCACCCCCCATGTTCAATTTTTCTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA |
| Name of Depositor: | SO Suh |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Teichostethus testaceous (Nitidulidae) ex Nodulisporium sp., Barro Colorado Island, Panama |
| Cross References: | Nucleotide (GenBank) : FJ172246 ITS including 5.8S rRNA gene |
| References: | Suh SO, et al. Expansion of the Candida tanzawaensis yeast clade: 16 novel Candida species from basidiocarp-feeding beetles. Int J Syst Evol Microbiol 54: 2409-2429, 2004. PubMed: 15545491 Kurtzman CP, Robnett CJ, Blackwell M. Description of Teunomyces gen. nov. for the Candida kruisii clade, Suhomyces gen. nov. for the Candida tanzawaensis clade and Suhomyces kilbournensis sp. nov. FEMS Yeast Res 16(5). pii: fow041, 2016. PubMed: 27188882 |