| 产品名称: | Mucor racemosus f. racemosus Fresen |
|---|---|
| 商品货号: | TS138881 |
| Deposited As: | Mucor mucedo (Linnaeus) Fresenius, teleomorph |
| Strain Designations: | 1202 |
| Application: | produces urate oxidase uricase |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®: | no |
| Morphology: | After 7 days on Potato dextrose medium at 25°C, colony is low, white, hyphae are hyaline, guttulate. Chlamydospores abundant, terminal or intercalary, single or in chains, globose, ovoidal or elongate. Sporulation not observed. |
| Medium: | ATCC® Medium 307: Cornmeal agar ATCC® Medium 310: Cornmeal, yeast, glucose agar (CMYG) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 20°C to 25°C
Atmosphere: Typical aerobicxa0 |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGGATCATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAG |
| Name of Depositor: | Soc. Etude Appl. Biochim. |
| U.S. Patent Number: | |
| Isolation: | soil |
| References: | Laboureur P, et al. Urate oxidase and process for the production thereof. US Patent 3,620,923 dated Nov 16 1971 |
| 产品名称: | Mucor racemosus f. racemosus Fresen |
|---|---|
| 商品货号: | TS138881 |
| Deposited As: | Mucor mucedo (Linnaeus) Fresenius, teleomorph |
| Strain Designations: | 1202 |
| Application: | produces urate oxidase uricase |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®: | no |
| Morphology: | After 7 days on Potato dextrose medium at 25°C, colony is low, white, hyphae are hyaline, guttulate. Chlamydospores abundant, terminal or intercalary, single or in chains, globose, ovoidal or elongate. Sporulation not observed. |
| Medium: | ATCC® Medium 307: Cornmeal agar ATCC® Medium 310: Cornmeal, yeast, glucose agar (CMYG) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 20°C to 25°C
Atmosphere: Typical aerobicxa0 |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGGATCATTAAATAATCAATAATCTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATAAGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGACTTTGATGGGGCCTCCCAAATAAATCTCTTTTAAATTTGATCTGAAATCAGGCGGGATTACCCGCTGAACTTAAG |
| Name of Depositor: | Soc. Etude Appl. Biochim. |
| U.S. Patent Number: | |
| Isolation: | soil |
| References: | Laboureur P, et al. Urate oxidase and process for the production thereof. US Patent 3,620,923 dated Nov 16 1971 |