| 产品名称: | Quantitative Synthetic Hepatitis C virus RNA |
|---|---|
| 商品货号: | TS143102 |
| Agent: | Quantitative Synthetic Hepatitis C virus RNA |
| Applications: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial with Biomatrica RNAstable |
| Storage Conditions: | -70°C or colder |
| Intended Use: | The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes fragments from 5’UTR and X-tail region (3’UTR). The following primers and probe can be used with this nucleic acid preparation Ref ![]() Young KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151:Forward: GCAGAAAGCGTCTAGCCATGGCGT Reverse: CTCGCAAGCACCCTATCAGGCAGT Probe: CATAGTGGTCTGCGGAACCGGTGAGT |
| Name of Depositor: | ATCC |
| Special Collection: | RNA |
| References: | Lee SC, et al. Improved version 2.0 qualitative and quantitative AMPLICOR reverse transcription-PCR tests for hepatitis C virus RNA: calibration to international units, enhanced genotype reactivity, and performance characteristics. J. Clin. Microbiol. 38(11): 4171-4179, 2000. PubMed: 11060086 Young KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151 |
| 产品名称: | Quantitative Synthetic Hepatitis C virus RNA |
|---|---|
| 商品货号: | TS143102 |
| Agent: | Quantitative Synthetic Hepatitis C virus RNA |
| Applications: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial with Biomatrica RNAstable |
| Storage Conditions: | -70°C or colder |
| Intended Use: | The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes fragments from 5’UTR and X-tail region (3’UTR). The following primers and probe can be used with this nucleic acid preparation Ref ![]() Young KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151:Forward: GCAGAAAGCGTCTAGCCATGGCGT Reverse: CTCGCAAGCACCCTATCAGGCAGT Probe: CATAGTGGTCTGCGGAACCGGTGAGT |
| Name of Depositor: | ATCC |
| Special Collection: | RNA |
| References: | Lee SC, et al. Improved version 2.0 qualitative and quantitative AMPLICOR reverse transcription-PCR tests for hepatitis C virus RNA: calibration to international units, enhanced genotype reactivity, and performance characteristics. J. Clin. Microbiol. 38(11): 4171-4179, 2000. PubMed: 11060086 Young KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151 |