| 产品名称: | Apiotrichum xylopini (Suh et al.) Kachalkin et al. |
|---|---|
| 商品货号: | TS143688 |
| Strain Designations: | EN6S23 |
| Application: | degrades cellulose and xylan. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Morphology: | On YM agar at 25°C for 7 days, colonies white to creamy white, wrinkled, margin filamentous. Cells ellipsoidal, asexual reproduction by budding, pseudohyphae observed. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCCTAGTGGCTTAAAACTATATCCATTTACACCTGTGAACCGTTTGATTGACACTCTGTGTTGATTTTACAAACAATATGTAAAGAAAGTCAAGTTATAATAACAAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGTGTTGCCAGTCTCTGGCTCGCCTTAAAGGAGTTAGCGAGTTTAACAATGTCGTCTGGCGTAATAAGTTTCGCTGGTAAGACTTGTGAAGTTTGCTTCTAATCGTCTTCGGACAATTACTTTGACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor: | CF Lee |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Soil under bamboo forest in Meishan, Chiayi, Taiwan. |
| Cross References: | Nucleotide (GenBank) : HQ005754 ITS including 5.8S rRNA gene |
| References: | Gujjari P, et al. Trichosporon xylopini sp. nov., a hemicellulose-degrading yeast isolated from wood-inhabiting beetle Xylopinus saperdioides. Int J Syst Evol Microbiol 61: 2538-2542, 2011. PubMed: 21037034 |
| 产品名称: | Apiotrichum xylopini (Suh et al.) Kachalkin et al. |
|---|---|
| 商品货号: | TS143688 |
| Strain Designations: | EN6S23 |
| Application: | degrades cellulose and xylan. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Morphology: | On YM agar at 25°C for 7 days, colonies white to creamy white, wrinkled, margin filamentous. Cells ellipsoidal, asexual reproduction by budding, pseudohyphae observed. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCCTAGTGGCTTAAAACTATATCCATTTACACCTGTGAACCGTTTGATTGACACTCTGTGTTGATTTTACAAACAATATGTAAAGAAAGTCAAGTTATAATAACAAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGTGTTGCCAGTCTCTGGCTCGCCTTAAAGGAGTTAGCGAGTTTAACAATGTCGTCTGGCGTAATAAGTTTCGCTGGTAAGACTTGTGAAGTTTGCTTCTAATCGTCTTCGGACAATTACTTTGACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor: | CF Lee |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Soil under bamboo forest in Meishan, Chiayi, Taiwan. |
| Cross References: | Nucleotide (GenBank) : HQ005754 ITS including 5.8S rRNA gene |
| References: | Gujjari P, et al. Trichosporon xylopini sp. nov., a hemicellulose-degrading yeast isolated from wood-inhabiting beetle Xylopinus saperdioides. Int J Syst Evol Microbiol 61: 2538-2542, 2011. PubMed: 21037034 |