| 产品名称: | Candida sp. |
|---|---|
| 商品货号: | TS143980 |
| Strain Designations: | S.P.A |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®: | no |
| Morphology: | After 7 days on YM agar at 25°C, colonies are white to cream-colored, soft, and smooth to wrinkled. Cells are spheroidal to ovoidal, and occur singly, in pairs, and short chains. |
| Medium: | ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | >D1/D2 region of 26S ribosomal RNA gene for TS143980
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATGGCTCTAGTAACGGCGAGTGAAGCAGCCAAAGCTCAAATTTGAAAGCTCCTAACAAGGCGCATTGTAATTTGAAGATGGTATTCCGAGTTAGTCCTTTACCTCAGTTCCTTGGAACAGGACGCCATAGAGGGTGAGAGCCCCGTGTGGTATTGGTAGCTTTCTCATGTGGTTTACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGAATTGGACTAGACTTGGATTTCTGTTATCAGCAGTCTTTCGGGGCTGTGCACTAGCAGTTTTCTAGGCCAGGATCTGTTTGGAGGCCAGGATAAAACCCAAAGAATGTGGCTCTTCGGAGTGTTATAGCTTTGGTTGAATACTGGCATTCTGGACAGAGGACCGCGCTTCGTGCTAGGATCCTGGCGTAATAGTCCTATTCCAC |
| Name of Depositor: | Liquichimica Biosintesi |
| U.S. Patent Number: | |
| Isolation: | soil from petrochemical complex, Italy |
| 产品名称: | Candida sp. |
|---|---|
| 商品货号: | TS143980 |
| Strain Designations: | S.P.A |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®: | no |
| Morphology: | After 7 days on YM agar at 25°C, colonies are white to cream-colored, soft, and smooth to wrinkled. Cells are spheroidal to ovoidal, and occur singly, in pairs, and short chains. |
| Medium: | ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | >D1/D2 region of 26S ribosomal RNA gene for TS143980
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATGGCTCTAGTAACGGCGAGTGAAGCAGCCAAAGCTCAAATTTGAAAGCTCCTAACAAGGCGCATTGTAATTTGAAGATGGTATTCCGAGTTAGTCCTTTACCTCAGTTCCTTGGAACAGGACGCCATAGAGGGTGAGAGCCCCGTGTGGTATTGGTAGCTTTCTCATGTGGTTTACCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGAATTGGACTAGACTTGGATTTCTGTTATCAGCAGTCTTTCGGGGCTGTGCACTAGCAGTTTTCTAGGCCAGGATCTGTTTGGAGGCCAGGATAAAACCCAAAGAATGTGGCTCTTCGGAGTGTTATAGCTTTGGTTGAATACTGGCATTCTGGACAGAGGACCGCGCTTCGTGCTAGGATCCTGGCGTAATAGTCCTATTCCAC |
| Name of Depositor: | Liquichimica Biosintesi |
| U.S. Patent Number: | |
| Isolation: | soil from petrochemical complex, Italy |