| 产品名称: | Filobasidiella neoformans Kwon-Chung, teleomorph |
|---|---|
| 商品货号: | TS144989 |
| Strain Designations: | CBS 6885, NRRL Y-17397 |
| Application: | Biomedical Research and Development Material |
| Biosafety Level: | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | yes (type strain, mating type alpha) |
| Antigenic Properties: | serotype D
Ref![]() Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |
| Preceptrol®: | no |
| Mating Type: | mates with ATCC 28958 mating type alpha self-fertile mates with ATCC 28958
Ref![]() Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. , Ref![]() Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA |
| Name of Depositor: | KJ Kwon-Chung |
| Isolation: | human bone lesion |
| References: | Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 type strain, mating type alpha type strain, mating type alpha Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |
| 产品名称: | Filobasidiella neoformans Kwon-Chung, teleomorph |
|---|---|
| 商品货号: | TS144989 |
| Strain Designations: | CBS 6885, NRRL Y-17397 |
| Application: | Biomedical Research and Development Material |
| Biosafety Level: | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | yes (type strain, mating type alpha) |
| Antigenic Properties: | serotype D
Ref![]() Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |
| Preceptrol®: | no |
| Mating Type: | mates with ATCC 28958 mating type alpha self-fertile mates with ATCC 28958
Ref![]() Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. , Ref![]() Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA |
| Name of Depositor: | KJ Kwon-Chung |
| Isolation: | human bone lesion |
| References: | Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 type strain, mating type alpha type strain, mating type alpha Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816 |