| 产品名称: | pICL |
|---|---|
| 商品货号: | TS154980 |
| Designations: | pICL |
| Depositors: | GG Hermanson |
| Biosafety Level: | 1 |
| Vector Information: | Size (kb): 8.3999996185302730 Vector: pICL (plasmid) Promoters: Promoter T7 (phi10) Construction: pTZ18R, pI-L13 Marker(s):ampR,LYS2 Construct size (kb): 8.399999618530273 Features: marker(s): ampR, LYS2 promoter: T7 (phi10) replicon: pMB1, ARS1 |
| Applications: | vector for other uses |
| Comments: | Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene. Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp. YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. TRP from pYAC4 is not really functional. Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5- GCGCTTAATGCGCCGCTACAGGGCG -3 and 5- GCTCACCGGCTCCAGATTTATCAGC -3, complementary to the f1 ori and ampR sequences respectively. The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori. |
| Media: | ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin |
| Growth Conditions: | Temperature: 37.0°C |
| References: | Hermanson GG, et al. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943-4948, 1991. PubMed: 1923762 Gary G Hermanson, personal communication |
| Shipped: | freeze-dried |
| 产品名称: | pICL |
|---|---|
| 商品货号: | TS154980 |
| Designations: | pICL |
| Depositors: | GG Hermanson |
| Biosafety Level: | 1 |
| Vector Information: | Size (kb): 8.3999996185302730 Vector: pICL (plasmid) Promoters: Promoter T7 (phi10) Construction: pTZ18R, pI-L13 Marker(s):ampR,LYS2 Construct size (kb): 8.399999618530273 Features: marker(s): ampR, LYS2 promoter: T7 (phi10) replicon: pMB1, ARS1 |
| Applications: | vector for other uses |
| Comments: | Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene. Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp. YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. TRP from pYAC4 is not really functional. Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5- GCGCTTAATGCGCCGCTACAGGGCG -3 and 5- GCTCACCGGCTCCAGATTTATCAGC -3, complementary to the f1 ori and ampR sequences respectively. The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori. |
| Media: | ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin |
| Growth Conditions: | Temperature: 37.0°C |
| References: | Hermanson GG, et al. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943-4948, 1991. PubMed: 1923762 Gary G Hermanson, personal communication |
| Shipped: | freeze-dried |