你好,请登录   免费注册    |    收藏本站
联系电话: 0574-87917803
联系电话: call_new 0574-87917803
Aspergillus oryzae (Ahlburg) Cohn
Aspergillus oryzae (Ahlburg) Cohn
规格:
货期:
编号:TS167300
品牌:Testobio
产品名称: Aspergillus oryzae (Ahlburg) Cohn
商品货号: TS167300
Deposited As: Aspergillus oryzae var. viridis Murakami
Strain Designations: RIB40
Application:
Produces acetamidase
Produces acid protease protease (acid)
Produces glucoamylase
Produces taka-amylase A
Cloning of the taka-amylase A gene
Cloning of the acetamidase gene
Cloning of the acid protease-encoding gene DDBJ D13894
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: no
Preceptrol®: no
Genome Sequenced Strain:

Yes

Comments:
Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan).
Medium: ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 312: Czapeks agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor: K Nojiro
Chain of Custody:
ATCC <-- K Nojiro <-- H. Murakami
Isolation:
Cereal
Cross References:

Nucleotide (GenBank) : KU729047 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729135 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA

Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae.

Nucleotide (GenBank) : JZJM00000000 Aspergillus oryzae RIB40, whole genome shotgun sequencing project

References:

Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981

Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550

Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839

Tada S, et al. Cloning and nucleotide sequence of the genomic Taka-amylase A gene of Aspergillus oryzae. Agric. Biol. Chem. 53: 593-599, 1989.

Nagashima T, et al. Site-directed mutagenesis of catalytic active-site residues of Taka-amylase A. Biosci. Biotech. Biochem. 56: 207-210, 1992.

Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978.

Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709

Ito K, Hanya Y, Koyama Y. Purification and characterization of a glutaminase enzyme accounting for the majority of glutaminase activity in Aspergillus sojae under solid-state culture. Appl. Microbiol. Biotechnol. 97: 8581-8590, 2013. PubMed: 23339014

Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591

Yanagisawa S, Kikuma T, Kitamoto K. Functional analysis of Aoatg1 and detection of the Cvt pathway in Aspergillus oryzae. FEMS Microbiol Lett 338: 168-176, 2013. PubMed: 23136971

Akao T, et al. Lack of endoplasmic reticulum 1,2-alpha-mannosidase activity that trims N-glycan Man9GlcNAc2 to Man8GlcNAc2 isomer B in a manE gene disruptant of Aspergillus oryzae. J. Biosci. Bioeng. 113: 438-441, 2012. PubMed: 22169093

Ogawa M, Kobayashi T, Koyama Y. ManR, a novel Zn(II)2Cys6 transcriptional activator, controls the beta-mannan utilization system in Aspergillus oryzae. Fungal Genet. Biol. 49: 987-995, 2012. PubMed: 23063954

Marui J, et al. Enzymatic properties of the glycine D-alanine corrected aminopeptidase of Aspergillus oryzae and its activity profiles in liquid-cultured mycelia and solid-state rice culture (rice koji). Appl. Microbiol. Biotechnol. 93: 655-669, 2012. PubMed: 22005737

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Kikuma T, Kitamoto K. Analysis of autophagy in Aspergillus oryzae by disruption of Aoatg13, Aoatg4, and Aoatg15 genes. FEMS Microbiol. Lett. 316: 61-69, 2011. PubMed: 21204928

Tokunaga C, Saitoh C, Kitamoto K. Cloning of Aspergillus oryzae Aovps5 gene, homologous to vacuolar protein sorting associated gene VPS5 and construction of the disruptant. J. Biosci. Bioeng. 108: 121-123, 2009. PubMed: 19619858

Ogasawara H, et al. Crawler, a novel Tc1/mariner-type transposable element in Aspergillus oryzae transposes under stress conditions. Fungal Genet. Biol. 46: 441-449, 2009. PubMed: 19269345

Higuchi Y, et al. Endocytosis is crucial for cell polarity and apical membrane recycling in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 8: 37-46, 2009. PubMed: 19028995

Escano CS, et al. Disruption of the Aopex11-1 gene involved in peroxisome proliferation leads to impaired Woronin body formation in Aspergillus oryzae. Eukaryot. Cell 8: 296-305, 2009. PubMed: 19136573

Shima Y, et al. Identification of three mutant loci conferring carboxin-resistance and development of a novel transformation system in Aspergillus oryzae. Fungal Genet. Biol. 46: 67-76, 2009. PubMed: 18992352

首页 > 产品中心 > 微生物培养 > 菌株 > null > Aspergillus oryzae (Ahlburg) Cohn

Aspergillus oryzae (Ahlburg) Cohn

  • 货号: TS167300
  • 好评
询价
  • 品牌 : TESTOBIO
产品名称: Aspergillus oryzae (Ahlburg) Cohn
商品货号: TS167300
Deposited As: Aspergillus oryzae var. viridis Murakami
Strain Designations: RIB40
Application:
Produces acetamidase
Produces acid protease protease (acid)
Produces glucoamylase
Produces taka-amylase A
Cloning of the taka-amylase A gene
Cloning of the acetamidase gene
Cloning of the acid protease-encoding gene DDBJ D13894
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: no
Preceptrol&reg;: no
Genome Sequenced Strain:

Yes

Comments:
Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan).
Medium: ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 312: Czapeks agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor: K Nojiro
Chain of Custody:
ATCC <-- K Nojiro <-- H. Murakami
Isolation:
Cereal
Cross References:

Nucleotide (GenBank) : KU729047 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729135 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA

Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae.

Nucleotide (GenBank) : JZJM00000000 Aspergillus oryzae RIB40, whole genome shotgun sequencing project

References:

Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981

Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550

Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839

Tada S, et al. Cloning and nucleotide sequence of the genomic Taka-amylase A gene of Aspergillus oryzae. Agric. Biol. Chem. 53: 593-599, 1989.

Nagashima T, et al. Site-directed mutagenesis of catalytic active-site residues of Taka-amylase A. Biosci. Biotech. Biochem. 56: 207-210, 1992.

Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978.

Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709

Ito K, Hanya Y, Koyama Y. Purification and characterization of a glutaminase enzyme accounting for the majority of glutaminase activity in Aspergillus sojae under solid-state culture. Appl. Microbiol. Biotechnol. 97: 8581-8590, 2013. PubMed: 23339014

Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591

Yanagisawa S, Kikuma T, Kitamoto K. Functional analysis of Aoatg1 and detection of the Cvt pathway in Aspergillus oryzae. FEMS Microbiol Lett 338: 168-176, 2013. PubMed: 23136971

Akao T, et al. Lack of endoplasmic reticulum 1,2-alpha-mannosidase activity that trims N-glycan Man9GlcNAc2 to Man8GlcNAc2 isomer B in a manE gene disruptant of Aspergillus oryzae. J. Biosci. Bioeng. 113: 438-441, 2012. PubMed: 22169093

Ogawa M, Kobayashi T, Koyama Y. ManR, a novel Zn(II)2Cys6 transcriptional activator, controls the beta-mannan utilization system in Aspergillus oryzae. Fungal Genet. Biol. 49: 987-995, 2012. PubMed: 23063954

Marui J, et al. Enzymatic properties of the glycine D-alanine corrected aminopeptidase of Aspergillus oryzae and its activity profiles in liquid-cultured mycelia and solid-state rice culture (rice koji). Appl. Microbiol. Biotechnol. 93: 655-669, 2012. PubMed: 22005737

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Kikuma T, Kitamoto K. Analysis of autophagy in Aspergillus oryzae by disruption of Aoatg13, Aoatg4, and Aoatg15 genes. FEMS Microbiol. Lett. 316: 61-69, 2011. PubMed: 21204928

Tokunaga C, Saitoh C, Kitamoto K. Cloning of Aspergillus oryzae Aovps5 gene, homologous to vacuolar protein sorting associated gene VPS5 and construction of the disruptant. J. Biosci. Bioeng. 108: 121-123, 2009. PubMed: 19619858

Ogasawara H, et al. Crawler, a novel Tc1/mariner-type transposable element in Aspergillus oryzae transposes under stress conditions. Fungal Genet. Biol. 46: 441-449, 2009. PubMed: 19269345

Higuchi Y, et al. Endocytosis is crucial for cell polarity and apical membrane recycling in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 8: 37-46, 2009. PubMed: 19028995

Escano CS, et al. Disruption of the Aopex11-1 gene involved in peroxisome proliferation leads to impaired Woronin body formation in Aspergillus oryzae. Eukaryot. Cell 8: 296-305, 2009. PubMed: 19136573

Shima Y, et al. Identification of three mutant loci conferring carboxin-resistance and development of a novel transformation system in Aspergillus oryzae. Fungal Genet. Biol. 46: 67-76, 2009. PubMed: 18992352

合作单位: