| 产品名称: | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品货号: | TS181881 |
| Deposited As: | Saccharomyces cerevisiae Hansen, teleomorph |
| Classification: | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations: | SS328 |
| Alternate State: | Candida robusta Diddens et Lodder |
| Application: | This material is available under the condition that it will not be used for commercial purpose or distributed to third parties. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Genotype: | MATalpha ade2-101 his3-delta200 lys2-801 ura3-52
Ref![]() Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 |
| Preceptrol®: | no |
| Mating Type: | alpha |
| Ploidy: | haploid |
| Comments: | This material is available under the condition that it will not be used for commercial purpose or distributed to third parties. |
| Morphology: | After 5 days at 25°C colonies butyrous and light cream colored.xa0 Cells are globose, ovoidal or elongate, (3.0-8.0) x (5.0-10.0) µm, and are usually isolated or in small groups.xa0 |
| Medium: | ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 25.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGCGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAA |
| Name of Depositor: | RJ Lin |
| Special Collection: | NCRR Contract |
| References: | Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 |
| 产品名称: | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品货号: | TS181881 |
| Deposited As: | Saccharomyces cerevisiae Hansen, teleomorph |
| Classification: | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations: | SS328 |
| Alternate State: | Candida robusta Diddens et Lodder |
| Application: | This material is available under the condition that it will not be used for commercial purpose or distributed to third parties. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Genotype: | MATalpha ade2-101 his3-delta200 lys2-801 ura3-52
Ref![]() Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 |
| Preceptrol®: | no |
| Mating Type: | alpha |
| Ploidy: | haploid |
| Comments: | This material is available under the condition that it will not be used for commercial purpose or distributed to third parties. |
| Morphology: | After 5 days at 25°C colonies butyrous and light cream colored.xa0 Cells are globose, ovoidal or elongate, (3.0-8.0) x (5.0-10.0) µm, and are usually isolated or in small groups.xa0 |
| Medium: | ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 25.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGCGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAA |
| Name of Depositor: | RJ Lin |
| Special Collection: | NCRR Contract |
| References: | Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 Kim DH, et al. A mutation in a methionine tRNA gene suppresses the prp2-1 Ts mutation and causes a pre-mRNA splicing defect in Saccharomyces cerevisiae. Genetics 153: 1105-1115, 1999. PubMed: 10545445 |