| 产品名称: | Dekkera bruxellensis van der Walt |
|---|---|
| 商品货号: | TS185128 |
| Strain Designations: | Y879 CBS 2499 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Wine spoilage yeast. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). Sequenced mitochondrial genome. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 26S ribosomal RNA gene
TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG |
| Name of Depositor: | J Piskur |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Wine, Medoc, France. |
| Cross References: | Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AHMD00000000 Brettanomyces bruxellensis CBS 2499, whole genome shotgun sequencing project |
| References: | Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6: 721-733, 2007. PubMed: 17277171 Crauwels S, et al. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing. Appl. Environ. Microbiol. 80: 4398-4413, 2014. PubMed: 24814796 Galafassi S, et al. Osmotic stress response in the wine yeast Dekkera bruxellensis. Food Microbiol 36: 316-319, 2013. PubMed: 24010612 Piskur J, et al. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties. Int J Food Microbiol 157: 202-209, 2012. PubMed: 22663979 Prochazka E, et al. Mitochondrial genome from the facultative anaerobe and petite-positive yeast Dekkera bruxellensis contains the NADH dehydrogenase subunit genes. FEMS Yeast Res 10: 545-557, 2010. PubMed: 20528950 |
| 产品名称: | Dekkera bruxellensis van der Walt |
|---|---|
| 商品货号: | TS185128 |
| Strain Designations: | Y879 CBS 2499 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Wine spoilage yeast. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). Sequenced mitochondrial genome. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 26S ribosomal RNA gene
TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG |
| Name of Depositor: | J Piskur |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Wine, Medoc, France. |
| Cross References: | Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AHMD00000000 Brettanomyces bruxellensis CBS 2499, whole genome shotgun sequencing project |
| References: | Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6: 721-733, 2007. PubMed: 17277171 Crauwels S, et al. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing. Appl. Environ. Microbiol. 80: 4398-4413, 2014. PubMed: 24814796 Galafassi S, et al. Osmotic stress response in the wine yeast Dekkera bruxellensis. Food Microbiol 36: 316-319, 2013. PubMed: 24010612 Piskur J, et al. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties. Int J Food Microbiol 157: 202-209, 2012. PubMed: 22663979 Prochazka E, et al. Mitochondrial genome from the facultative anaerobe and petite-positive yeast Dekkera bruxellensis contains the NADH dehydrogenase subunit genes. FEMS Yeast Res 10: 545-557, 2010. PubMed: 20528950 |