| 产品名称: | Alternaria sp. |
|---|---|
| 商品货号: | TS186872 |
| Deposited As: | Stemphylium botryosum f. sp. lycopersici Rotem et al., anamorph |
| Strain Designations: | StI/7 |
| Application: | produces stemphyloxin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | The ITS sequence indicated that the strain could be Alternaria tenuissima or Alternaria alternata. The species identity of this strain may need further investigation. |
| Morphology: | After 2 weeks colonies growing rapidly, velvety, tan to light brown. xa0Conidiophores pale golden brown, smooth-walled. Conidia arising in unbranched chains of 3-5, obclavate or tapering gradually into a beak, golden brown, smooth-walled or slightly verruculose, generally with 4-7 transverse and one or two longitudinal septa, 22-95 x 8-19 µm. |
| Medium: | ATCC® Medium 343: V8 juice agar |
| Growth Conditions: | Temperature: 24°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
xa0xa0 GGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor: | I Barash |
| Chain of Custody: | ATCC < |
| Isolation: | tomato, Israel |
| References: | Barash I, et al. Crystallization and x-ray analysis of stemphyloxin I, a phytotoxin from Stemphylium botryosum. Science 220: 1065-1066, 1983. |
| 产品名称: | Alternaria sp. |
|---|---|
| 商品货号: | TS186872 |
| Deposited As: | Stemphylium botryosum f. sp. lycopersici Rotem et al., anamorph |
| Strain Designations: | StI/7 |
| Application: | produces stemphyloxin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | The ITS sequence indicated that the strain could be Alternaria tenuissima or Alternaria alternata. The species identity of this strain may need further investigation. |
| Morphology: | After 2 weeks colonies growing rapidly, velvety, tan to light brown. xa0Conidiophores pale golden brown, smooth-walled. Conidia arising in unbranched chains of 3-5, obclavate or tapering gradually into a beak, golden brown, smooth-walled or slightly verruculose, generally with 4-7 transverse and one or two longitudinal septa, 22-95 x 8-19 µm. |
| Medium: | ATCC® Medium 343: V8 juice agar |
| Growth Conditions: | Temperature: 24°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
xa0xa0 GGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor: | I Barash |
| Chain of Custody: | ATCC < |
| Isolation: | tomato, Israel |
| References: | Barash I, et al. Crystallization and x-ray analysis of stemphyloxin I, a phytotoxin from Stemphylium botryosum. Science 220: 1065-1066, 1983. |