| 产品名称: | Quantitative Synthetic Mycoplasma genitalium DNA |
|---|---|
| 商品货号: | TS187167 |
| Application: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determinexa0bacterial load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial in Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | This product is intended for research use only. It is not intended for any animal or human therapeutic or diagnostic use. The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Preceptrol®: | no |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes fragments from the 16S gene, mgpA, and gap. The following primers and probe can be used with this nucleic acid preparation Ref ![]() Hardick J, et al. Performance of the gen-probe transcription-mediated corrected amplification research assay compared to that of a multitarget real-time PCR for Mycoplasma genitalium detection. J. Clin. Microbiol. 44(4): 1236-1240, 2006. PubMed: 16597844:Forward primer: GTAATACATAGGTCGCAAGCGTTATC Reverse primer: CACCACCTGTCACTCGGTTAACCTC Probe: CTGTCGGAGCGATCCCTTCGGT |
| Special Collection: | DNA |
| References: | Hardick J, et al. Performance of the gen-probe transcription-mediated corrected amplification research assay compared to that of a multitarget real-time PCR for Mycoplasma genitalium detection. J. Clin. Microbiol. 44(4): 1236-1240, 2006. PubMed: 16597844 |
| 产品名称: | Quantitative Synthetic Mycoplasma genitalium DNA |
|---|---|
| 商品货号: | TS187167 |
| Application: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determinexa0bacterial load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial in Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | This product is intended for research use only. It is not intended for any animal or human therapeutic or diagnostic use. The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Preceptrol®: | no |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes fragments from the 16S gene, mgpA, and gap. The following primers and probe can be used with this nucleic acid preparation Ref ![]() Hardick J, et al. Performance of the gen-probe transcription-mediated corrected amplification research assay compared to that of a multitarget real-time PCR for Mycoplasma genitalium detection. J. Clin. Microbiol. 44(4): 1236-1240, 2006. PubMed: 16597844:Forward primer: GTAATACATAGGTCGCAAGCGTTATC Reverse primer: CACCACCTGTCACTCGGTTAACCTC Probe: CTGTCGGAGCGATCCCTTCGGT |
| Special Collection: | DNA |
| References: | Hardick J, et al. Performance of the gen-probe transcription-mediated corrected amplification research assay compared to that of a multitarget real-time PCR for Mycoplasma genitalium detection. J. Clin. Microbiol. 44(4): 1236-1240, 2006. PubMed: 16597844 |