| 产品名称: | Pithomyces chartarum (Berkeley et Curtis) Ellis |
|---|---|
| 商品货号: | TS187426 |
| Deposited As: | Pithomyces chartarum (Berkeley et Curtis) Ellis, anamorph |
| Strain Designations: | 68/1558 |
| Alternate State: | Leptosphaerulina chartarum Roux, teleomorph |
| Application: | produces sporidesmin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Toxigenic |
| Morphology: | After 8 days on Rabbit food medium at room temperature with a natural light/dark cycle, colonies are flat, white, ringed with black powdery spore masses. Spores are obovoid, rough-walled, mid-brown, becoming dark brown and opaque with age, 3-4 euseptate with one or more median cells divided by longitudinal septa. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 340: Rabbit food agar |
| Growth Conditions: | Temperature: 24°C to 26° Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGGATCATTAACCTTTCAAATCAGGGTGCGTCGCGGCCCCCGAGGAGCGGAAACAATCCTTGGGAGGTTTGCGGAGTCTTCGGACCCCTTAACGCACGCACGACTGCCATCCTTACTTTACGAGCACCTTCTGTTCTCCCTCGGCGGGGCAACCTGCCGTTGGAACCGAATAAACTCTTTTTGCATCTAGCATTACCTGTTCCGAAACAAACAATCGTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCGCCTCCGCGCGTGGACTCGCCCCAAATTCATTGGCAGCGGTCCTTGCCTCCTCTCGCGCAGCACATTGCGCTTCTCGAGGGGCTACGGCTCGCGTCCAACAAGCACATTTACCGTCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA |
| Name of Depositor: | PA Wyatt |
| Chain of Custody: | ATCC |
| Isolation: | horse skin, New Zealand |
| References: | DiMenna ME, et al. Sporidesmin production and sporulation in Pithomyces chartarum. J. Gen. Microbiol. 61: 87-96, 1970. PubMed: 5531450 |
| 产品名称: | Pithomyces chartarum (Berkeley et Curtis) Ellis |
|---|---|
| 商品货号: | TS187426 |
| Deposited As: | Pithomyces chartarum (Berkeley et Curtis) Ellis, anamorph |
| Strain Designations: | 68/1558 |
| Alternate State: | Leptosphaerulina chartarum Roux, teleomorph |
| Application: | produces sporidesmin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Toxigenic |
| Morphology: | After 8 days on Rabbit food medium at room temperature with a natural light/dark cycle, colonies are flat, white, ringed with black powdery spore masses. Spores are obovoid, rough-walled, mid-brown, becoming dark brown and opaque with age, 3-4 euseptate with one or more median cells divided by longitudinal septa. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 340: Rabbit food agar |
| Growth Conditions: | Temperature: 24°C to 26° Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGGATCATTAACCTTTCAAATCAGGGTGCGTCGCGGCCCCCGAGGAGCGGAAACAATCCTTGGGAGGTTTGCGGAGTCTTCGGACCCCTTAACGCACGCACGACTGCCATCCTTACTTTACGAGCACCTTCTGTTCTCCCTCGGCGGGGCAACCTGCCGTTGGAACCGAATAAACTCTTTTTGCATCTAGCATTACCTGTTCCGAAACAAACAATCGTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATCTACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCGCCTCCGCGCGTGGACTCGCCCCAAATTCATTGGCAGCGGTCCTTGCCTCCTCTCGCGCAGCACATTGCGCTTCTCGAGGGGCTACGGCTCGCGTCCAACAAGCACATTTACCGTCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA |
| Name of Depositor: | PA Wyatt |
| Chain of Custody: | ATCC |
| Isolation: | horse skin, New Zealand |
| References: | DiMenna ME, et al. Sporidesmin production and sporulation in Pithomyces chartarum. J. Gen. Microbiol. 61: 87-96, 1970. PubMed: 5531450 |