| 产品名称: | Wallemia mellicola Jancic et al. |
|---|---|
| 商品货号: | TS189631 |
| Deposited As: | Wallemia sebi |
| Strain Designations: | CBS 633.66 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Osmophilic fungus. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Medium: | ATCC® Medium 340: Rabbit food agar ATCC® Medium 323: Malt agar medium ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 28S ribosomal RNA gene
AGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGA |
| Name of Depositor: | CBS |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Date honey |
| Cross References: | Nucleotide (GenBank) : HQ263368 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AFQX00000000 Wallemia mellicola CBS 633.66, whole genome shotgun sequencing project |
| References: | Jančič S, et al. A taxonomic revision of the Wallemia sebi species complex. PLoS One 10: e0125933. PubMed: 26017053 Padamsee M, et al. The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction. Fungal Genet Biol 49: 217-226, 2012. PubMed: 22326418 Nguyen HD, et al. Application of the phylogenetic species concept to Wallemia sebi from house dust and indoor air revealed by multi-locus genealogical concordance. PLoS One 10: e0120894. PubMed: 25799362 |
| 产品名称: | Wallemia mellicola Jancic et al. |
|---|---|
| 商品货号: | TS189631 |
| Deposited As: | Wallemia sebi |
| Strain Designations: | CBS 633.66 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Osmophilic fungus. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Medium: | ATCC® Medium 340: Rabbit food agar ATCC® Medium 323: Malt agar medium ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 28S ribosomal RNA gene
AGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGA |
| Name of Depositor: | CBS |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Date honey |
| Cross References: | Nucleotide (GenBank) : HQ263368 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AFQX00000000 Wallemia mellicola CBS 633.66, whole genome shotgun sequencing project |
| References: | Jančič S, et al. A taxonomic revision of the Wallemia sebi species complex. PLoS One 10: e0125933. PubMed: 26017053 Padamsee M, et al. The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction. Fungal Genet Biol 49: 217-226, 2012. PubMed: 22326418 Nguyen HD, et al. Application of the phylogenetic species concept to Wallemia sebi from house dust and indoor air revealed by multi-locus genealogical concordance. PLoS One 10: e0120894. PubMed: 25799362 |