| 产品名称: | Candida jiufengensis Bai et Ji |
|---|---|
| 商品货号: | TS189933 |
| Strain Designations: | HJG-2.1.3 AS 2.3688, CBS 10846 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. mitochondrial genome sequenced strain |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 25°C
Atmosphere: Typical aerobic |
| Sequenced Data: | ITS DNA sequence of MYA-4593 lot 58704089
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTAAGTGCTTAATTGCATTTTTACACATGTGTTTTTCTTTATTTAAAACTTACTTTGGTAGTGGTATTAACTTATTCGCTGCCAGAGATTAAACTTAAAACAAATTTTTATTTTAATTGTCAAATAAGATTATATAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCATACCTTCGGGTTTGGTGTTGAGCAATACGTAGGGTTTGCTTGAAAGAAAGTAGGAGTATAACTAATGGATAGGTTTTTCCACTCATTGGACAACTCCAAAATTTTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC |
| Name of Depositor: | FY Bai |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Oxycetonia jucunda, Jiufeng Mountain, Beijing, China. |
| Cross References: | Nucleotide (GenBank) : GU291261 ITS including 5.8S rRNA gene |
| References: | Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009. Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011. PubMed: 21266473 |
| 产品名称: | Candida jiufengensis Bai et Ji |
|---|---|
| 商品货号: | TS189933 |
| Strain Designations: | HJG-2.1.3 AS 2.3688, CBS 10846 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. mitochondrial genome sequenced strain |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 25°C
Atmosphere: Typical aerobic |
| Sequenced Data: | ITS DNA sequence of MYA-4593 lot 58704089
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTAAGTGCTTAATTGCATTTTTACACATGTGTTTTTCTTTATTTAAAACTTACTTTGGTAGTGGTATTAACTTATTCGCTGCCAGAGATTAAACTTAAAACAAATTTTTATTTTAATTGTCAAATAAGATTATATAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCATACCTTCGGGTTTGGTGTTGAGCAATACGTAGGGTTTGCTTGAAAGAAAGTAGGAGTATAACTAATGGATAGGTTTTTCCACTCATTGGACAACTCCAAAATTTTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC |
| Name of Depositor: | FY Bai |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Oxycetonia jucunda, Jiufeng Mountain, Beijing, China. |
| Cross References: | Nucleotide (GenBank) : GU291261 ITS including 5.8S rRNA gene |
| References: | Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009. Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011. PubMed: 21266473 |