| 产品名称: | pMTGFbeta3 |
|---|---|
| 商品货号: | TS198816 |
| Designations: | pMTGFbeta3 |
| GenBank Number: | M32745 |
| Species: | Mus musculus, mouse |
| Depositors: | S Qian |
| Vector: | Construct size (kb): 4.183000087738037 |
| Insert: | DNA: cDNA Insert lengths(kb): 1.233000040054321 Tissue: Harvey-ras-transformed NIH 3T3 cells Gene product: transforming growth factor, beta-3 Tgfb3 |
| Insert Size (kb): | 1.233 |
| Media: | ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: freeze-dried |
| Comments: | Restriction digests of the clone give the following sizes (kb): XbaI/HindIII--2.95, 1.3; BglII--4.2; SmaI--4.2; SacI--3.4, 0.8; PvuII--2.6, 1.6. The insert includes the following restriction sites (approximate kb from the 5 end): BglII--0.13, SmaI--0.22; SacI--0.5; XmnI--0.7; PvuII--1.19, 1.22. Contains the complete coding sequence, corresponding to nt 611-1843 of the sequence record. The 5 oligonucleotide sequence was chosen to start with the second ATG codon. It is therefore possible that the region encoding two additional amino terminal amino acids was not amplified using these oligonucleotides. Amplified from mRNA pooled from mouse embryos and 3 different cell lines using ATG-containing 5 ATGCACTTGCAAAGGGCTCTG 3 and TGA complement-containing oligonucleotides 5 CCCGTTAACTCAGCTGCACTTGCAGGA 3. Transcription from the T3 promoter gives the sense strand. |
| Classification: | Eukaryota, Animalia, Metazoa, Chordata, Vertebrata, Tetrapod |
| References: | Denhez F, et al. Cloning by polymerase chain reaction of a new mouse TGF-beta, mTGF-beta3. Growth Factors 3: 139-146, 1990. PubMed: 2206556 Su. Wen Qian, personal communication |
| 产品名称: | pMTGFbeta3 |
|---|---|
| 商品货号: | TS198816 |
| Designations: | pMTGFbeta3 |
| GenBank Number: | M32745 |
| Species: | Mus musculus, mouse |
| Depositors: | S Qian |
| Vector: | Construct size (kb): 4.183000087738037 |
| Insert: | DNA: cDNA Insert lengths(kb): 1.233000040054321 Tissue: Harvey-ras-transformed NIH 3T3 cells Gene product: transforming growth factor, beta-3 Tgfb3 |
| Insert Size (kb): | 1.233 |
| Media: | ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: freeze-dried |
| Comments: | Restriction digests of the clone give the following sizes (kb): XbaI/HindIII--2.95, 1.3; BglII--4.2; SmaI--4.2; SacI--3.4, 0.8; PvuII--2.6, 1.6. The insert includes the following restriction sites (approximate kb from the 5 end): BglII--0.13, SmaI--0.22; SacI--0.5; XmnI--0.7; PvuII--1.19, 1.22. Contains the complete coding sequence, corresponding to nt 611-1843 of the sequence record. The 5 oligonucleotide sequence was chosen to start with the second ATG codon. It is therefore possible that the region encoding two additional amino terminal amino acids was not amplified using these oligonucleotides. Amplified from mRNA pooled from mouse embryos and 3 different cell lines using ATG-containing 5 ATGCACTTGCAAAGGGCTCTG 3 and TGA complement-containing oligonucleotides 5 CCCGTTAACTCAGCTGCACTTGCAGGA 3. Transcription from the T3 promoter gives the sense strand. |
| Classification: | Eukaryota, Animalia, Metazoa, Chordata, Vertebrata, Tetrapod |
| References: | Denhez F, et al. Cloning by polymerase chain reaction of a new mouse TGF-beta, mTGF-beta3. Growth Factors 3: 139-146, 1990. PubMed: 2206556 Su. Wen Qian, personal communication |