| 产品名称: | Kazachstania intestinalis Suh et Zhou |
|---|---|
| 商品货号: | TS199448 |
| Deposited As: | Kazachstania sp. |
| Strain Designations: | EH089 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. |
| Morphology: | On MD-0200 after 7 days at 25 C, colonies are white to creamy white, butyrous, smooth surface, and entire margin. Cells ellipsoidal 3.75-4.5µm x 6-6.75µm, asci observerd containing 2 ascospores (indicated by the arrow in the picture), pseudohyphae and hyphae not present. |
| Medium: | ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 20.0-25.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TGCGGAAGGATCATTAAAGAAATATCGAAAAATTTGCGTGGGTGTTCCCATCCAAACAGACACCTGGTTTCTTCTCCTGGGCCTGCGCTTAACTGCGCGGCCTAATTACAAAGGGAGAGGGTTCCGCCCGTCTGGGGAGTGCCAATTTAAGCGCGAGTATTTTCTCACACACGATGGAGACTTTTCTCATATCATTTTTTCACATCTTCTTTGGGGGGCGCAAGCTTCCCAGAGGTGACAAACACAAACAACTTTGCAATGCATTTATTATTATTCAGAACAAGCAGTCTTCGGATTGAAAAATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACTCGTGTTTGGTTGTGAGTGACACTCTTTCTCTGAGTTAGCTTGAAATTGCTAGCCATAGCGCGAAACACCGCTGGAACTGTATGTGTATCAAGCACATGCTAGTATTTTAGTCGTACTAGGTTTTACCAACTGCGGCGCTGTACTGGTGTGACTTACTGTTTGGTGCATTAGTCTCTTCTGTGTATTTTTGTGCGGCGAACAATACTCTTTAAGTT |
| Name of Depositor: | SO Suh |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Odontotaenius disjunctus from rotten log, Bull Run Mt., Broad Run, Virginia, USA. |
| Cross References: | Nucleotide (GenBank) : HQ260339 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : HQ260336, HQ999969 ITS including 5.8S rRNA gene |
| References: | Suh SO, Zhou JJ. Kazachstania intestinalis sp. nov., an ascosporogenous yeast from the gut of passalid beetle Odontotaenius disjunctus. Antonie van Leeuwenhoek 100: 109-115, 2011. PubMed: 21380505 |
| 产品名称: | Kazachstania intestinalis Suh et Zhou |
|---|---|
| 商品货号: | TS199448 |
| Deposited As: | Kazachstania sp. |
| Strain Designations: | EH089 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. |
| Morphology: | On MD-0200 after 7 days at 25 C, colonies are white to creamy white, butyrous, smooth surface, and entire margin. Cells ellipsoidal 3.75-4.5µm x 6-6.75µm, asci observerd containing 2 ascospores (indicated by the arrow in the picture), pseudohyphae and hyphae not present. |
| Medium: | ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 20.0-25.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TGCGGAAGGATCATTAAAGAAATATCGAAAAATTTGCGTGGGTGTTCCCATCCAAACAGACACCTGGTTTCTTCTCCTGGGCCTGCGCTTAACTGCGCGGCCTAATTACAAAGGGAGAGGGTTCCGCCCGTCTGGGGAGTGCCAATTTAAGCGCGAGTATTTTCTCACACACGATGGAGACTTTTCTCATATCATTTTTTCACATCTTCTTTGGGGGGCGCAAGCTTCCCAGAGGTGACAAACACAAACAACTTTGCAATGCATTTATTATTATTCAGAACAAGCAGTCTTCGGATTGAAAAATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACTCGTGTTTGGTTGTGAGTGACACTCTTTCTCTGAGTTAGCTTGAAATTGCTAGCCATAGCGCGAAACACCGCTGGAACTGTATGTGTATCAAGCACATGCTAGTATTTTAGTCGTACTAGGTTTTACCAACTGCGGCGCTGTACTGGTGTGACTTACTGTTTGGTGCATTAGTCTCTTCTGTGTATTTTTGTGCGGCGAACAATACTCTTTAAGTT |
| Name of Depositor: | SO Suh |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Odontotaenius disjunctus from rotten log, Bull Run Mt., Broad Run, Virginia, USA. |
| Cross References: | Nucleotide (GenBank) : HQ260339 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : HQ260336, HQ999969 ITS including 5.8S rRNA gene |
| References: | Suh SO, Zhou JJ. Kazachstania intestinalis sp. nov., an ascosporogenous yeast from the gut of passalid beetle Odontotaenius disjunctus. Antonie van Leeuwenhoek 100: 109-115, 2011. PubMed: 21380505 |