| 产品名称: | Quantitative Synthetic Cyclospora cayetanensis DNA |
|---|---|
| 商品货号: | TS203572 |
| Strain Designations: | Quantitative Synthetic Cyclospora cayetanensis DNA |
| Application: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine protozoan load and for other molecular biology applications. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial in Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | This product is intended for research use only. It is not intended for any animal or human therapeutic or diagnostic use. The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes the full 18S rRNA gene sequence, and full ITS1 and ITS2 sequences. The following primers and probe can be used with this nucleic acid preparation Ref ![]() Varma M, et al. Detection of Cyclospora cayetanens using a quantitative real-time PCR assay. J. Microbiol. Methods 53(1): 27-36, 2003. PubMed: 12609720:Forward primer: TGAACTCATTGGACTGACCAGC Reverse primer: ACTTTTGCATCCTTTAGAGGGCT Probe: FAM-CAACTTTCCGACCAGCTCCGCGAA-BHQ1 |
| Name of Depositor: | ATCC |
| Special Collection: | DNA |
| References: | Varma M, et al. Detection of Cyclospora cayetanens using a quantitative real-time PCR assay. J. Microbiol. Methods 53(1): 27-36, 2003. PubMed: 12609720 |
| 产品名称: | Quantitative Synthetic Cyclospora cayetanensis DNA |
|---|---|
| 商品货号: | TS203572 |
| Strain Designations: | Quantitative Synthetic Cyclospora cayetanensis DNA |
| Application: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine protozoan load and for other molecular biology applications. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 to 1 x 106 copies/µL 100 µL per vial in Biomatrica DNAstable |
| Storage Conditions: | -20°C or colder |
| Intended Use: | This product is intended for research use only. It is not intended for any animal or human therapeutic or diagnostic use. The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes the full 18S rRNA gene sequence, and full ITS1 and ITS2 sequences. The following primers and probe can be used with this nucleic acid preparation Ref ![]() Varma M, et al. Detection of Cyclospora cayetanens using a quantitative real-time PCR assay. J. Microbiol. Methods 53(1): 27-36, 2003. PubMed: 12609720:Forward primer: TGAACTCATTGGACTGACCAGC Reverse primer: ACTTTTGCATCCTTTAGAGGGCT Probe: FAM-CAACTTTCCGACCAGCTCCGCGAA-BHQ1 |
| Name of Depositor: | ATCC |
| Special Collection: | DNA |
| References: | Varma M, et al. Detection of Cyclospora cayetanens using a quantitative real-time PCR assay. J. Microbiol. Methods 53(1): 27-36, 2003. PubMed: 12609720 |