| 产品名称: | Aspergillus flavus Link var. flavus |
|---|---|
| 商品货号: | TS205725 |
| Strain Designations: | MC-21 CBS 282.95, IMI 370082 |
| Application: | produces aflatoxin B1 aflatoxin B produces aflatoxin B2 produces aflatoxins |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA) |
| Medium: | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG D1D2 region of the 28S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGA |
| Name of Depositor: | JL Richard |
| Isolation: | moldy corn, Iowa |
| References: | Klich MA, et al. Aspergillus reference cultures. New Orleans and Baarn: International Commission on Penicillium and Aspergillus; 1996. Richard JL, et al. Toxigenic fungi associated with stored corn. Mycopathol. Mycol. Appl. 38: 313-326, 1969. PubMed: 5392813 Richard JJ, Cysewski SJ. Occurrence of aflatoxin producing strains of Aspergillus flavus Link in stored corn. Mycopathol. Mycol. Appl. 44: 221-229, 1971. Wei DL, Jong SC. Production of aflatoxins by strains of the Aspergillus flavus group maintained in ATCC. Mycopathologia 93: 19-24, 1986. PubMed: 3083260 Nakamura H, et al. Evaluation of the aflatoxin biosynthetic genes for identification of the Aspergillus section Flavi. Microbes Environ. 26: 367-369, 2011. PubMed: 21791886 Lee CZ, Liou GY, Yuan GF. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152: 161-170, 2006. PubMed: 16385126 |
| 产品名称: | Aspergillus flavus Link var. flavus |
|---|---|
| 商品货号: | TS205725 |
| Strain Designations: | MC-21 CBS 282.95, IMI 370082 |
| Application: | produces aflatoxin B1 aflatoxin B produces aflatoxin B2 produces aflatoxins |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA) |
| Medium: | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG D1D2 region of the 28S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGA |
| Name of Depositor: | JL Richard |
| Isolation: | moldy corn, Iowa |
| References: | Klich MA, et al. Aspergillus reference cultures. New Orleans and Baarn: International Commission on Penicillium and Aspergillus; 1996. Richard JL, et al. Toxigenic fungi associated with stored corn. Mycopathol. Mycol. Appl. 38: 313-326, 1969. PubMed: 5392813 Richard JJ, Cysewski SJ. Occurrence of aflatoxin producing strains of Aspergillus flavus Link in stored corn. Mycopathol. Mycol. Appl. 44: 221-229, 1971. Wei DL, Jong SC. Production of aflatoxins by strains of the Aspergillus flavus group maintained in ATCC. Mycopathologia 93: 19-24, 1986. PubMed: 3083260 Nakamura H, et al. Evaluation of the aflatoxin biosynthetic genes for identification of the Aspergillus section Flavi. Microbes Environ. 26: 367-369, 2011. PubMed: 21791886 Lee CZ, Liou GY, Yuan GF. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152: 161-170, 2006. PubMed: 16385126 |