| 产品名称: | Aspergillus flavus Link var. flavus |
|---|---|
| 商品货号: | TS205744 |
| Deposited As: | Aspergillus oryzae (Ahlburg) Cohn, anamorph |
| Strain Designations: | NRRL 695 38, CBS 125.59, IMI 52143 |
| Application: | produces amylase produces single-cell protein SCP degrades mussel-processing wastes |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Preceptrol®: | no |
| Morphology: | After 5-7 days colonies yellowish-green; conidial heads radiate, conidiogenous cells uni- and biseriate; conidiophore stipes rough-walled, hyaline; vesicles spherical; conidia echinulate, (sub)spherical, 3.5 µm diam. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | xa0xa0xa0xa0xa0xa0 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
CTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT |
| Name of Depositor: | NRRL |
| Chain of Custody: | ATCC < |
| Cross References: | Nucleotide (GenBank) : JQ070072 ITS including 5.8S rRNA gene |
| References: | Meded. Fac. Landbouwwet. Univ. Gent 59/4b: 2471-2473, 1994. Underkofler LA, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry: use of mold amylase. Ind. Eng. Chem. 31: 734-738, 1939. Schoene L, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry. Comaprison of several saccharifying agents. Ind. Eng. Chem. 32: 544-547, 1940. Hao LC, et al. Fungal amylases as saccharifying agents in the alcoholic fermentation of corn. Ind. Eng. Chem. 35: 814-818, 1943. Murado MA, et al. Characterization of microbial biomasses and amylolytic preparations obtained from mussel processing waste treatment. Bioresour. Technol. 43: 117-125, 1993. |
| 产品名称: | Aspergillus flavus Link var. flavus |
|---|---|
| 商品货号: | TS205744 |
| Deposited As: | Aspergillus oryzae (Ahlburg) Cohn, anamorph |
| Strain Designations: | NRRL 695 38, CBS 125.59, IMI 52143 |
| Application: | produces amylase produces single-cell protein SCP degrades mussel-processing wastes |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Preceptrol®: | no |
| Morphology: | After 5-7 days colonies yellowish-green; conidial heads radiate, conidiogenous cells uni- and biseriate; conidiophore stipes rough-walled, hyaline; vesicles spherical; conidia echinulate, (sub)spherical, 3.5 µm diam. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | xa0xa0xa0xa0xa0xa0 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
CTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT |
| Name of Depositor: | NRRL |
| Chain of Custody: | ATCC < |
| Cross References: | Nucleotide (GenBank) : JQ070072 ITS including 5.8S rRNA gene |
| References: | Meded. Fac. Landbouwwet. Univ. Gent 59/4b: 2471-2473, 1994. Underkofler LA, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry: use of mold amylase. Ind. Eng. Chem. 31: 734-738, 1939. Schoene L, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry. Comaprison of several saccharifying agents. Ind. Eng. Chem. 32: 544-547, 1940. Hao LC, et al. Fungal amylases as saccharifying agents in the alcoholic fermentation of corn. Ind. Eng. Chem. 35: 814-818, 1943. Murado MA, et al. Characterization of microbial biomasses and amylolytic preparations obtained from mussel processing waste treatment. Bioresour. Technol. 43: 117-125, 1993. |