| 产品名称: | Schizochytrium aggregatum Goldstein et Belsky |
|---|---|
| 商品货号: | TS206420 |
| Classification: | KINGDOM: Chromista |
| Strain Designations: | 16 |
| Application: | Biofuel production |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Morphology: | After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed. |
| Medium: | ATCC® Medium 790: By+ medium |
| Growth Conditions: | Temperature: 20°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
Partial 18S ribosomal RNA gene CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGGTAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTGGTGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTT |
| Name of Depositor: | DJ Alderman |
| Chain of Custody: | ATCC |
| Isolation: | seawater, West Germany |
| Cross References: | Nucleotide (GenBank) : M13616 Schizochytrium aggregatum 5S rRNA. Nucleotide (GenBank) : X06104 Schizochytorium aggregatum 5S ribosomal RNA. |
| References: | Honda D, et al. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 46: 637-647, 1999. PubMed: 10568038 Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 50: 129-140, 2009. PubMed: 18977305 |
| 产品名称: | Schizochytrium aggregatum Goldstein et Belsky |
|---|---|
| 商品货号: | TS206420 |
| Classification: | KINGDOM: Chromista |
| Strain Designations: | 16 |
| Application: | Biofuel production |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Morphology: | After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed. |
| Medium: | ATCC® Medium 790: By+ medium |
| Growth Conditions: | Temperature: 20°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
Partial 18S ribosomal RNA gene CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGGTAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTGGTGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTT |
| Name of Depositor: | DJ Alderman |
| Chain of Custody: | ATCC |
| Isolation: | seawater, West Germany |
| Cross References: | Nucleotide (GenBank) : M13616 Schizochytrium aggregatum 5S rRNA. Nucleotide (GenBank) : X06104 Schizochytorium aggregatum 5S ribosomal RNA. |
| References: | Honda D, et al. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 46: 637-647, 1999. PubMed: 10568038 Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 50: 129-140, 2009. PubMed: 18977305 |