| 产品名称: | Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
|---|---|
| 商品货号: | TS208961 |
| Deposited As: | Mycoderma lipolytica |
| Strain Designations: | 251 CBS 2072, IFO 1742, KCM-0232 |
| Synonym: | Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
| Alternate State: | Candida lipolytica (Harrison) Diddens et Lodder |
| Application: | Control strain for identification
Quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | yes |
| Comments: | Growth factor |
| Morphology: | After 3 days on YM agar at 25°C, colonies are white, raised, wrinkled and dull. Cells are ovoid to cylindrical, pseudohyphae abundant and well-differentiated. |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTATCTATTTCTGTGGATTTCTATTCTATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCCTTCATCCGAGATTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCAC |
| Name of Depositor: | PR Burkholder |
| Cross References: | Nucleotide (GenBank) : EU252546 ITS including 5.8S rRNA gene |
| References: | Burkholder PR, et al. Studies on some growth factors of yeasts. J. Bacteriol. 48: 385-391, 1944. Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903 Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320 RapID™ Yeast PLUS QC Set. Remel™. Arteau M, Labrie S, Roy D. Terminal-restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis profiling of fungal communities in Camembert cheese. Int. Dairy J. 20: 545-554, 2010. |
| 产品名称: | Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
|---|---|
| 商品货号: | TS208961 |
| Deposited As: | Mycoderma lipolytica |
| Strain Designations: | 251 CBS 2072, IFO 1742, KCM-0232 |
| Synonym: | Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
| Alternate State: | Candida lipolytica (Harrison) Diddens et Lodder |
| Application: | Control strain for identification
Quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | yes |
| Comments: | Growth factor |
| Morphology: | After 3 days on YM agar at 25°C, colonies are white, raised, wrinkled and dull. Cells are ovoid to cylindrical, pseudohyphae abundant and well-differentiated. |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTTTATCTATTTCTGTGGATTTCTATTCTATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCCTTCATCCGAGATTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCAC |
| Name of Depositor: | PR Burkholder |
| Cross References: | Nucleotide (GenBank) : EU252546 ITS including 5.8S rRNA gene |
| References: | Burkholder PR, et al. Studies on some growth factors of yeasts. J. Bacteriol. 48: 385-391, 1944. Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903 Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320 RapID™ Yeast PLUS QC Set. Remel™. Arteau M, Labrie S, Roy D. Terminal-restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis profiling of fungal communities in Camembert cheese. Int. Dairy J. 20: 545-554, 2010. |