你好,请登录   免费注册    |    收藏本站
联系电话: 0574-87917803
联系电话: call_new 0574-87917803
Chaetomium globosum Kunze : Fries
Chaetomium globosum Kunze : Fries
规格:
货期:
编号:TS209370
品牌:Testobio
产品名称: Chaetomium globosum Kunze : Fries
商品货号: TS209370
Strain Designations: QM 459 1042.4, CBS 148.51, CBS 161.52, CEB 1218.1, CEB 1218.2, CECT 2701, DSM 1962, IFO 6347, IMI 45550, MUCL 1984, NRRL 1870, UPSC 3159, VTT D-81079
Application:
Bacterial resistance testing adhesives
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing airborne equipment
Fungus resistance testing aircraft transmissions
Fungus resistance testing automotive components
Fungus resistance testing packing materials
Fungus resistance testing paper and paperboard
Fungus resistance testing plastics
Fungus resistance testing polymers
Fungus resistance testing sandbags
Fungus resistance testing textiles
Produces endoglucanase
Sterility assurance
Testing aerosols
Testing slimicide
Degrades cotton fabric
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: no
Preceptrol®: no
Genome Sequenced Strain:

Yes

Comments:
Genome sequencing strain (Broad Institute, USA).
Medium: ATCC® Medium 329: Mineral salts agar
ATCC® Medium 340: Rabbit food agar
ATCC® Medium 307: Cornmeal agar
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic; Filter paper required as carbon source.
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGATGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGTCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC

Name of Depositor: QM
Chain of Custody:
ATCC
Isolation:
Stored cotton, Washington, DC
Cross References:

Nucleotide (GenBank) : KC146352 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146368 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AAFU00000000 Chaetomium globosum CBS 148.51, whole genome shotgun sequencing project

Nucleotide (GenBank) : EF524036 Chaetomium globosum strain TS209370 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence.

References:

Greathouse GA, Ames LM. Fabric deterioration by thirteen described and three new species of Chaetomium. Mycologia 37: 138-155, 1945.

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

ASTM International Standard Test Method for Mildew (Fungus) Resistance of Paper and Paperboard. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 2020-92 (Reapproved 2003).

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Bailey PJ, et al. Isolation and characterization of cellulase (beta-1,4-glucan 4-glucanohydrolase) from Chaetomium globosum Kunze. Mater. Org. 7: 27-43, 1972.

Iannarone M, Blasecki JW Jr.. Microbiological testing of aerosol preparations using Chaetomium globosum. J. Pharm. Sci. 55: 1471-1472, 1966.

Standard Test Method for Efficacy of Slimicides for the Paper Industry-Bacterial and Fungal Slime. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 1839-07.

Methods of testing materials for resistance to fungal growth. Part 2: Resistance of textiles to fungal growth.. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.2-1998.

Methods of testing materials for resistance to fungal growth. Part 3: Resistance of cordage and yarns to fungal growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.3-1999.

Methods of testing materials for resistance to fungal growth. Part 4: Resistance of coated fabrics and electronic boards to fungal growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.4-1999.

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Sterilization of single-use medical devices incorporating materials of animal origin--Validation and routine control of sterilization by liquid chemical sterilants. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14160:1998.

Plastics--Assessment of the effectiveness of fungistatic compounds in plastics formulations. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 16869:2001.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Standard Specification for Poly(Vinyl Chloride) (PVC) Plastic Flexible Concealed Water-Containment Membrane. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4551-96 (Reapproved 2001).

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Sterilization of single-use medical devices incorporating materials of animal origin --- Validation and routine control of sterilization by liquid chemical sterilants, Annex A. London, UK:British Standards Institution;British Standard BS EN ISO 14160:1998.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Cuomo CA, et al. Draft genome sequence of the cellulolytic fungus Chaetomium globosum. Genome Announc. 3: e00021-15, 2015. PubMed: 25720678

首页 > 产品中心 > 微生物培养 > 菌株 > null > Chaetomium globosum Kunze : Fries

Chaetomium globosum Kunze : Fries

  • 货号: TS209370
  • 好评
询价
  • 品牌 : TESTOBIO
产品名称: Chaetomium globosum Kunze : Fries
商品货号: TS209370
Strain Designations: QM 459 1042.4, CBS 148.51, CBS 161.52, CEB 1218.1, CEB 1218.2, CECT 2701, DSM 1962, IFO 6347, IMI 45550, MUCL 1984, NRRL 1870, UPSC 3159, VTT D-81079
Application:
Bacterial resistance testing adhesives
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing airborne equipment
Fungus resistance testing aircraft transmissions
Fungus resistance testing automotive components
Fungus resistance testing packing materials
Fungus resistance testing paper and paperboard
Fungus resistance testing plastics
Fungus resistance testing polymers
Fungus resistance testing sandbags
Fungus resistance testing textiles
Produces endoglucanase
Sterility assurance
Testing aerosols
Testing slimicide
Degrades cotton fabric
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: no
Preceptrol®: no
Genome Sequenced Strain:

Yes

Comments:
Genome sequencing strain (Broad Institute, USA).
Medium: ATCC® Medium 329: Mineral salts agar
ATCC® Medium 340: Rabbit food agar
ATCC® Medium 307: Cornmeal agar
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic; Filter paper required as carbon source.
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGATGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGTCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC

Name of Depositor: QM
Chain of Custody:
ATCC
Isolation:
Stored cotton, Washington, DC
Cross References:

Nucleotide (GenBank) : KC146352 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146368 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AAFU00000000 Chaetomium globosum CBS 148.51, whole genome shotgun sequencing project

Nucleotide (GenBank) : EF524036 Chaetomium globosum strain TS209370 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence.

References:

Greathouse GA, Ames LM. Fabric deterioration by thirteen described and three new species of Chaetomium. Mycologia 37: 138-155, 1945.

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

ASTM International Standard Test Method for Mildew (Fungus) Resistance of Paper and Paperboard. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 2020-92 (Reapproved 2003).

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Bailey PJ, et al. Isolation and characterization of cellulase (beta-1,4-glucan 4-glucanohydrolase) from Chaetomium globosum Kunze. Mater. Org. 7: 27-43, 1972.

Iannarone M, Blasecki JW Jr.. Microbiological testing of aerosol preparations using Chaetomium globosum. J. Pharm. Sci. 55: 1471-1472, 1966.

Standard Test Method for Efficacy of Slimicides for the Paper Industry-Bacterial and Fungal Slime. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 1839-07.

Methods of testing materials for resistance to fungal growth. Part 2: Resistance of textiles to fungal growth.. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.2-1998.

Methods of testing materials for resistance to fungal growth. Part 3: Resistance of cordage and yarns to fungal growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.3-1999.

Methods of testing materials for resistance to fungal growth. Part 4: Resistance of coated fabrics and electronic boards to fungal growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 1157.4-1999.

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Sterilization of single-use medical devices incorporating materials of animal origin--Validation and routine control of sterilization by liquid chemical sterilants. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14160:1998.

Plastics--Assessment of the effectiveness of fungistatic compounds in plastics formulations. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 16869:2001.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Standard Specification for Poly(Vinyl Chloride) (PVC) Plastic Flexible Concealed Water-Containment Membrane. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4551-96 (Reapproved 2001).

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Sterilization of single-use medical devices incorporating materials of animal origin --- Validation and routine control of sterilization by liquid chemical sterilants, Annex A. London, UK:British Standards Institution;British Standard BS EN ISO 14160:1998.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Cuomo CA, et al. Draft genome sequence of the cellulolytic fungus Chaetomium globosum. Genome Announc. 3: e00021-15, 2015. PubMed: 25720678

合作单位: