你好,请登录   免费注册    |    收藏本站
联系电话: 0574-87917803
联系电话: call_new 0574-87917803
Candida tropicalis (Castellani) Berkhout
Candida tropicalis (Castellani) Berkhout
规格:
货期:
编号:TS210448
品牌:Testobio
产品名称: Candida tropicalis (Castellani) Berkhout
商品货号: TS210448
Deposited As: Monilia tropicalis (Castellani) Castellani et Chalmers
Strain Designations: 1909, ATCC 4563, ATCC 7349, CBS 94, CCRC 20520, IFO 1070, IFO 1400, JCM 1541, NRRL Y-12699, NRRL Y-12968, NRRL Y-607
Application:
Assay of chloro-8-quinolinol
Bacterial resistance testing
Degrades xylose D-xylose
Fungus resistance testing adhesives
Produces aspartic proteinases aspartyl proteinases
Produces ethyl alcohol ethanol
Produces xylitol
Susceptibility disc testing
Susceptibility testing
Produces xylitol from D-xylose
Control strain for typing systems
Produces ethanol from D-xylose
Control strain to test oxygen availability in bioreactor in space laboratory
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing.
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: yes
Preceptrol®: yes
Genome Sequenced Strain:

Yes

Ploidy: diploid
Comments:
Fluconazole-sensitive
Utilizes phenol, catechol and 3- and 4-methylcatechols as sole carbon source
Esterase activity
MIC of 2-hydroxychalcone, 75 mcg/ml
Adherence to lysophospholipids
Genome sequencing strain (Genolevures Consortium, France; Wellcome Trust Sanger Institute, UK).
For additional infromation, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Mitochondrial genome sequenced strain
Medium: ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons modification of Sabourauds agar
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGAATGTGGCACGGCTTCGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor: A Castellani
Isolation:
Patient with bronchomycosis
Cross References:

Nucleotide (GenBank) : KU729064 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729147 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : AX110837 Sequence 1570 from Patent WO0123604.

Nucleotide (GenBank) : U45749 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : M60308 C. tropicalis small subunit ribosomal RNA.

Nucleotide (GenBank) : M23673 Candida tropicalis (TS210448) cytochrome P450 lanosterol

Nucleotide (GenBank) : AF194419 Candida tropicalis multidrug resistance protein (MDR1) gene,

Nucleotide (GenBank) : AF218992 Candida tropicalis strain TS210448T 5.8S ribosomal RNA gene,

Nucleotide (GenBank) : M15945 Yeast (C. tropicalis) P450alk gene encoding the alkane-inducible

Nucleotide (GenBank) : M35199 C. tropicalis NADPH-cytochrome P450 reductase gene, complete cds.

Nucleotide (GenBank) : M24894 Candida tropicalis alkane-inducible cytochrome P450 gene, complete

Nucleotide (GenBank) : U00675 Candida tropicalis D-arabinitol dehydrogenase (ARD) gene, complete

References:

Mahmourides, G et al. Ethanol accumulation in cultures of Pachysolen tannophilus on D-xylose is associated with a transition to a state of low oxygen consumption. Bio-Technology 3: 59-62, 1985.

Walther I, et al. Development of a miniature bioreactor for continuous culture in a space laboratory. J Biotechnol 38: 21-32, 1994. PubMed: 7765579

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett Appl Microbiol 18: 53-55, 1994.

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Castellani A. Observations on "tropical broncho-oidiosis". Br Med J 2: 868-869, 1910.

Lentz DL, et al. The anticandidal properties of chlorinated 8-quinolinols. Mycologia 88: 651-654, 1996.

J Gen Appl Microbiol 19: 171-187, 1973.

Prakobphol A, et al. Specific adherence of Candida tropicalis to lysophospholipids. Biochemistry 33: 9496-9503, 1994. PubMed: 8068624

Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747

Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

Winkelhausen E, Kuzmanova S. Microbial conversion of D-xylose to xylitol. J Ferment Bioeng 86: 1-14, 1998.

de Viragh PA, et al. Cloning and sequencing of two Candida parapsilosis genes encoding acid proteases. J Gen Microbiol 139: 335-342, 1993. PubMed: 8436951

Sanglard D, Fiechter A. DNA transformations of Candida tropicalis with replicating and integrative vectors. Yeast 8: 1065-1075, 1992. PubMed: 1293885

Barchiese F, et al. Experimental induction of fluconazole resistance in Candida tropicalis TS210448. Antimicrob Agents Chemother 44: 1578-1584, 2000. PubMed: 10817712

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5 end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Zaugg C, et al. Secreted aspartic proteinase family of Candida tropicalis. Infect Immun 69: 405-412, 2001. PubMed: 11119531

Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Blandin G, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 16. Candida tropicalis. FEBS Lett 487: 91-94, 2000.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011. PubMed: 21266473

Forastiero A, et al. Candida tropicalis antifungal cross-resistance is related to different azole target (Erg11p) modifications. Antimicrob Agents Chemother 57: 4769-4781, 2013. PubMed: 23877676

Bisha B, Kim HJ, Brehm-Stecher BF. Improved DNA-FISH for cytometric detection of Candida spp. J Appl Microbiol 110: 881-892, 2011. PubMed: 21205104

Cornet M, et al. Molecular identification of closely related Candida species using two ribosomal intergenic spacer fingerprinting methods. J Mol Diagn 13: 12-22, 2011. PubMed: 21227390

Kurtzman CP, Suzuki M. Phylogenetic analysis of ascomycete yeasts that form coenzyme Q-9 and the proposal of the new genera Babjeviella, Meyerozyma, Millerozyma, Priceomyces, and Scheffersomyces. Mycoscience 51: 2-14, 2010.

Gunisova S, et al. Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA 15: 546-559, 2009. PubMed: 19223441

Desnos-Ollivier M, et al. Clonal population of flucytosine-resistant Candida tropicalis from blood cultures, Paris, France. Emerg Infect Dis 14: 557-565, 2008. PubMed: 18394272

Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340

Leinberger DM, et al. Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses. J Clin Microbiol 43: 4943-4953, 2005. PubMed: 16207946

Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J Clin Microbiol 42: 5624-5635, 2004. PubMed: 15583292

首页 > 产品中心 > 微生物培养 > 菌株 > null > Candida tropicalis (Castellani) Berkhout

Candida tropicalis (Castellani) Berkhout

  • 货号: TS210448
  • 好评
询价
  • 品牌 : TESTOBIO
产品名称: Candida tropicalis (Castellani) Berkhout
商品货号: TS210448
Deposited As: Monilia tropicalis (Castellani) Castellani et Chalmers
Strain Designations: 1909, ATCC 4563, ATCC 7349, CBS 94, CCRC 20520, IFO 1070, IFO 1400, JCM 1541, NRRL Y-12699, NRRL Y-12968, NRRL Y-607
Application:
Assay of chloro-8-quinolinol
Bacterial resistance testing
Degrades xylose D-xylose
Fungus resistance testing adhesives
Produces aspartic proteinases aspartyl proteinases
Produces ethyl alcohol ethanol
Produces xylitol
Susceptibility disc testing
Susceptibility testing
Produces xylitol from D-xylose
Control strain for typing systems
Produces ethanol from D-xylose
Control strain to test oxygen availability in bioreactor in space laboratory
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing.
Biosafety Level: 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format: freeze-dried
Storage Conditions: Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain: yes
Preceptrol®: yes
Genome Sequenced Strain:

Yes

Ploidy: diploid
Comments:
Fluconazole-sensitive
Utilizes phenol, catechol and 3- and 4-methylcatechols as sole carbon source
Esterase activity
MIC of 2-hydroxychalcone, 75 mcg/ml
Adherence to lysophospholipids
Genome sequencing strain (Genolevures Consortium, France; Wellcome Trust Sanger Institute, UK).
For additional infromation, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Mitochondrial genome sequenced strain
Medium: ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons modification of Sabourauds agar
Growth Conditions:
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data:
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGAATGTGGCACGGCTTCGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor: A Castellani
Isolation:
Patient with bronchomycosis
Cross References:

Nucleotide (GenBank) : KU729064 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729147 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : AX110837 Sequence 1570 from Patent WO0123604.

Nucleotide (GenBank) : U45749 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : M60308 C. tropicalis small subunit ribosomal RNA.

Nucleotide (GenBank) : M23673 Candida tropicalis (TS210448) cytochrome P450 lanosterol

Nucleotide (GenBank) : AF194419 Candida tropicalis multidrug resistance protein (MDR1) gene,

Nucleotide (GenBank) : AF218992 Candida tropicalis strain TS210448T 5.8S ribosomal RNA gene,

Nucleotide (GenBank) : M15945 Yeast (C. tropicalis) P450alk gene encoding the alkane-inducible

Nucleotide (GenBank) : M35199 C. tropicalis NADPH-cytochrome P450 reductase gene, complete cds.

Nucleotide (GenBank) : M24894 Candida tropicalis alkane-inducible cytochrome P450 gene, complete

Nucleotide (GenBank) : U00675 Candida tropicalis D-arabinitol dehydrogenase (ARD) gene, complete

References:

Mahmourides, G et al. Ethanol accumulation in cultures of Pachysolen tannophilus on D-xylose is associated with a transition to a state of low oxygen consumption. Bio-Technology 3: 59-62, 1985.

Walther I, et al. Development of a miniature bioreactor for continuous culture in a space laboratory. J Biotechnol 38: 21-32, 1994. PubMed: 7765579

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett Appl Microbiol 18: 53-55, 1994.

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Castellani A. Observations on "tropical broncho-oidiosis". Br Med J 2: 868-869, 1910.

Lentz DL, et al. The anticandidal properties of chlorinated 8-quinolinols. Mycologia 88: 651-654, 1996.

J Gen Appl Microbiol 19: 171-187, 1973.

Prakobphol A, et al. Specific adherence of Candida tropicalis to lysophospholipids. Biochemistry 33: 9496-9503, 1994. PubMed: 8068624

Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747

Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

Winkelhausen E, Kuzmanova S. Microbial conversion of D-xylose to xylitol. J Ferment Bioeng 86: 1-14, 1998.

de Viragh PA, et al. Cloning and sequencing of two Candida parapsilosis genes encoding acid proteases. J Gen Microbiol 139: 335-342, 1993. PubMed: 8436951

Sanglard D, Fiechter A. DNA transformations of Candida tropicalis with replicating and integrative vectors. Yeast 8: 1065-1075, 1992. PubMed: 1293885

Barchiese F, et al. Experimental induction of fluconazole resistance in Candida tropicalis TS210448. Antimicrob Agents Chemother 44: 1578-1584, 2000. PubMed: 10817712

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5 end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Zaugg C, et al. Secreted aspartic proteinase family of Candida tropicalis. Infect Immun 69: 405-412, 2001. PubMed: 11119531

Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Blandin G, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 16. Candida tropicalis. FEBS Lett 487: 91-94, 2000.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011. PubMed: 21266473

Forastiero A, et al. Candida tropicalis antifungal cross-resistance is related to different azole target (Erg11p) modifications. Antimicrob Agents Chemother 57: 4769-4781, 2013. PubMed: 23877676

Bisha B, Kim HJ, Brehm-Stecher BF. Improved DNA-FISH for cytometric detection of Candida spp. J Appl Microbiol 110: 881-892, 2011. PubMed: 21205104

Cornet M, et al. Molecular identification of closely related Candida species using two ribosomal intergenic spacer fingerprinting methods. J Mol Diagn 13: 12-22, 2011. PubMed: 21227390

Kurtzman CP, Suzuki M. Phylogenetic analysis of ascomycete yeasts that form coenzyme Q-9 and the proposal of the new genera Babjeviella, Meyerozyma, Millerozyma, Priceomyces, and Scheffersomyces. Mycoscience 51: 2-14, 2010.

Gunisova S, et al. Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA 15: 546-559, 2009. PubMed: 19223441

Desnos-Ollivier M, et al. Clonal population of flucytosine-resistant Candida tropicalis from blood cultures, Paris, France. Emerg Infect Dis 14: 557-565, 2008. PubMed: 18394272

Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340

Leinberger DM, et al. Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses. J Clin Microbiol 43: 4943-4953, 2005. PubMed: 16207946

Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J Clin Microbiol 42: 5624-5635, 2004. PubMed: 15583292

合作单位: