| 产品名称: | Candida tropicalis (Castellani) Berkhout |
|---|---|
| 商品货号: | TS210461 |
| Strain Designations: | AmMS 227 |
| Application: | Quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24°C toxa026°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTAC |
| Name of Depositor: | GJ De Leon |
| Isolation: | Not available. |
| Cross References: | Nucleotide (GenBank) : EU266571 ITS including 5.8S rRNA gene |
| References: | MicroScan Yeast ID QC Set. Dade/Siemens. |
| 产品名称: | Candida tropicalis (Castellani) Berkhout |
|---|---|
| 商品货号: | TS210461 |
| Strain Designations: | AmMS 227 |
| Application: | Quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24°C toxa026°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTAC |
| Name of Depositor: | GJ De Leon |
| Isolation: | Not available. |
| Cross References: | Nucleotide (GenBank) : EU266571 ITS including 5.8S rRNA gene |
| References: | MicroScan Yeast ID QC Set. Dade/Siemens. |