| 产品名称: | Candida geochares (van der Walt et al.) Meyer et Yarrow |
|---|---|
| 商品货号: | TS210597 |
| Deposited As: | Torulopsis geochares van der Walt et al. |
| Strain Designations: | CBS 6870 CCRC 22394, IFO 10278, NRRL Y-17073 |
| Application: | quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Morphology: | After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 325: Malt extract agar (Blakeslees formula) |
| Growth Conditions: | Temperature: 24°Cxa0to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC |
| Name of Depositor: | CBS |
| Chain of Custody: | ATCC <-- CBS <-- J.P. van der Walt |
| Isolation: | Grassland soil; South Africa |
| References: | van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080 YT MicroPlate QC Set. Biolog. Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281 Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998. Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5 end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410 |
| 产品名称: | Candida geochares (van der Walt et al.) Meyer et Yarrow |
|---|---|
| 商品货号: | TS210597 |
| Deposited As: | Torulopsis geochares van der Walt et al. |
| Strain Designations: | CBS 6870 CCRC 22394, IFO 10278, NRRL Y-17073 |
| Application: | quality control strain |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Morphology: | After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 325: Malt extract agar (Blakeslees formula) |
| Growth Conditions: | Temperature: 24°Cxa0to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC |
| Name of Depositor: | CBS |
| Chain of Custody: | ATCC <-- CBS <-- J.P. van der Walt |
| Isolation: | Grassland soil; South Africa |
| References: | van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080 YT MicroPlate QC Set. Biolog. Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281 Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998. Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5 end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410 |