| 产品名称： | Aspergillus niger van Tieghem |
|---|---|
| 商品货号： | TS213131 |
| Strain Designations： | WB 326 CBS 554.65, IMI 50566, NRRL 326; 2766 |
| Application： | Produces aniline Produces gluconic acid Produces glucose oxidase Produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase Produces kynureninase-type enzymes Produces pergolide sulfone Produces pergolide sulfoxide Produces pseudonigeron (1-3)-alpha-D-glucan Degrades: pulp and paper-mill wastewater Fermentation of tannin-gallic acid Transformation of sesquiterpene lactone costunolide Transformation of acetanilide to aniline Transformation of pergolide to pergolide sulfoxide and pergolide sulfone |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | yes |
| Comments： | Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA) Structure of galactomannan |
| Medium： | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC Beta-tubulin (bTub) TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG |
| Name of Depositor： | KB Raper, DI Fennell |
| Chain of Custody： | ATCC |
| Isolation： | Not available. |
| Cross References： | Nucleotide (GenBank) : KU729129 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : FJ195350 ITS including 5.8S rRNA gene |
| References： | Storm AM, Gasner LL. Treatment of pulp mill wastes. US Patent 3,737,374 dated Jun 5 1973 Klich MA, et al. Aspergillus reference cultures. New Orleans and Baarn: International Commission on Penicillium and Aspergillus; 1996. Al-Musallam A Revision of the black Aspergillus species, 1980 Raper KB, Fennell DI. The genus Aspergillus. Baltimore: Williams & Wilkins; 1965. Bardalaye PC, Nordin JH. Chemical structure of the galactomannan from the cell wall of Aspergillus niger. J. Biol. Chem. 252: 2584-2591, 1977. PubMed: 856795 Lasswell WL, et al. An undergraduate experiment in pharmacognosy: the microbial biotransformation of acetanilide by Aspergillus species. Am. J. Pharm. Educ. 47: 127-129, 1983. Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979. Smith RV, et al. Microbial transformations of pergolide to pergolide sulfoxide and pergolide sulfone. J. Pharm. Sci. 72: 733-736, 1983. PubMed: 6684155 Horisberger M, et al. Structure of A (1--->3) -alpha-D-glucan (pseudonigeron) of Aspergillus niger NRRL 326 cell wall. Carbohydr. Res. 23: 183-188, 1972. PubMed: 4340387 Witte K, Wartenberg A. Purification and properties of two beta-glucosidases isolated from Aspergillus niger. Acta Biotechnol. 9: 179-190, 1989. Murado MA, et al. Enhancement of the bioproduction potential of an amylaceous effluent. Bioresour. Technol. 44: 155-163, 1993. Shetty AS, Gaertner FH. Kynureninase-type enzymes of Penicillium roqueforti, Aspergillus niger, Rhizpus stolonifer, and Pseudomonas fluorescens: Further evidence for distinct kynureninase and hydroxykynureninase activities. J. Bacteriol. 122: 235-244, 1975. PubMed: 164432 FF MicroPlate. Biolog. Lawrence DP, et al. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous Ascomycota. PLoS One 6: e28231, 2011. PubMed: 22140558 Andersen MR, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 21: 885-897, 2011. PubMed: 21543515 Yamada O, et al. Molecular biological researches of Kuro-Koji molds, their classification and safety. J. Biosci. Bioeng. 112: 233-237, 2011. PubMed: 21641278 Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197 Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947 Serra R, et al. Aspergillus ibericus: a new species of section Nigri isolated from grapes. Mycologia 98: 295-306, 2006. PubMed: 16894975 Bau M, et al. DNA-based characterization of ochratoxin-A-producing and non-producing Aspergillus carbonarius strains from grapes. Res. Microbiol. 156: 375-381, 2005. PubMed: 15808942 Shimoda M, et al. Accelerated death kinetics of Aspergillus niger spores under high-pressure carbonation. Appl. Environ. Microbiol. 68: 4162-4167, 2002. PubMed: 12147527 Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515, 2000. PubMed: 10747135 Perrone G, et al. Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger strains isolated from grapes in Italy. Appl. Environ. Microbiol. 72: 680-685, 2006. PubMed: 16391107 |
产品中心 Product Center
联系我们CONTACT US
-
0574-87917803
24小时服务热线 -
testobio@163.com
销售邮箱 -
浙江省宁波市高新区晶辉路866弄33号智造港E4幢3楼
地址
联系方式
-
章丽敏
17757489010 -
朱静
18067106081 -
李晴
18067408036 -
李晶晶
13375187189 -
周雪
13372109301
| 产品名称： | Aspergillus niger van Tieghem |
|---|---|
| 商品货号： | TS213131 |
| Strain Designations： | WB 326 CBS 554.65, IMI 50566, NRRL 326; 2766 |
| Application： | Produces aniline Produces gluconic acid Produces glucose oxidase Produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase Produces kynureninase-type enzymes Produces pergolide sulfone Produces pergolide sulfoxide Produces pseudonigeron (1-3)-alpha-D-glucan Degrades: pulp and paper-mill wastewater Fermentation of tannin-gallic acid Transformation of sesquiterpene lactone costunolide Transformation of acetanilide to aniline Transformation of pergolide to pergolide sulfoxide and pergolide sulfone |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | yes |
| Comments： | Aspergillus reference strain for identification and morphological observation recommended by the International Commission on Penicillium and Aspergillus (ICPA) Structure of galactomannan |
| Medium： | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC Beta-tubulin (bTub) TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG |
| Name of Depositor： | KB Raper, DI Fennell |
| Chain of Custody： | ATCC |
| Isolation： | Not available. |
| Cross References： | Nucleotide (GenBank) : KU729129 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : FJ195350 ITS including 5.8S rRNA gene |
| References： | Storm AM, Gasner LL. Treatment of pulp mill wastes. US Patent 3,737,374 dated Jun 5 1973 Klich MA, et al. Aspergillus reference cultures. New Orleans and Baarn: International Commission on Penicillium and Aspergillus; 1996. Al-Musallam A Revision of the black Aspergillus species, 1980 Raper KB, Fennell DI. The genus Aspergillus. Baltimore: Williams & Wilkins; 1965. Bardalaye PC, Nordin JH. Chemical structure of the galactomannan from the cell wall of Aspergillus niger. J. Biol. Chem. 252: 2584-2591, 1977. PubMed: 856795 Lasswell WL, et al. An undergraduate experiment in pharmacognosy: the microbial biotransformation of acetanilide by Aspergillus species. Am. J. Pharm. Educ. 47: 127-129, 1983. Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979. Smith RV, et al. Microbial transformations of pergolide to pergolide sulfoxide and pergolide sulfone. J. Pharm. Sci. 72: 733-736, 1983. PubMed: 6684155 Horisberger M, et al. Structure of A (1--->3) -alpha-D-glucan (pseudonigeron) of Aspergillus niger NRRL 326 cell wall. Carbohydr. Res. 23: 183-188, 1972. PubMed: 4340387 Witte K, Wartenberg A. Purification and properties of two beta-glucosidases isolated from Aspergillus niger. Acta Biotechnol. 9: 179-190, 1989. Murado MA, et al. Enhancement of the bioproduction potential of an amylaceous effluent. Bioresour. Technol. 44: 155-163, 1993. Shetty AS, Gaertner FH. Kynureninase-type enzymes of Penicillium roqueforti, Aspergillus niger, Rhizpus stolonifer, and Pseudomonas fluorescens: Further evidence for distinct kynureninase and hydroxykynureninase activities. J. Bacteriol. 122: 235-244, 1975. PubMed: 164432 FF MicroPlate. Biolog. Lawrence DP, et al. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous Ascomycota. PLoS One 6: e28231, 2011. PubMed: 22140558 Andersen MR, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 21: 885-897, 2011. PubMed: 21543515 Yamada O, et al. Molecular biological researches of Kuro-Koji molds, their classification and safety. J. Biosci. Bioeng. 112: 233-237, 2011. PubMed: 21641278 Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197 Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947 Serra R, et al. Aspergillus ibericus: a new species of section Nigri isolated from grapes. Mycologia 98: 295-306, 2006. PubMed: 16894975 Bau M, et al. DNA-based characterization of ochratoxin-A-producing and non-producing Aspergillus carbonarius strains from grapes. Res. Microbiol. 156: 375-381, 2005. PubMed: 15808942 Shimoda M, et al. Accelerated death kinetics of Aspergillus niger spores under high-pressure carbonation. Appl. Environ. Microbiol. 68: 4162-4167, 2002. PubMed: 12147527 Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515, 2000. PubMed: 10747135 Perrone G, et al. Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger strains isolated from grapes in Italy. Appl. Environ. Microbiol. 72: 680-685, 2006. PubMed: 16391107 |
